Incidental Mutation 'R5668:Trpm5'
ID442444
Institutional Source Beutler Lab
Gene Symbol Trpm5
Ensembl Gene ENSMUSG00000009246
Gene Nametransient receptor potential cation channel, subfamily M, member 5
Synonyms9430099A16Rik, Mtr1, Ltrpc5
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5668 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143069153-143094642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143073229 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1085 (D1085G)
Ref Sequence ENSEMBL: ENSMUSP00000009390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000060433] [ENSMUST00000105920] [ENSMUST00000133410] [ENSMUST00000137856] [ENSMUST00000147995] [ENSMUST00000150867] [ENSMUST00000177841] [ENSMUST00000208779]
Predicted Effect probably benign
Transcript: ENSMUST00000009390
AA Change: D1085G

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: D1085G

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060433
SMART Domains Protein: ENSMUSP00000056582
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 91 207 3.9e-43 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105920
SMART Domains Protein: ENSMUSP00000101540
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126776
Predicted Effect probably benign
Transcript: ENSMUST00000133410
SMART Domains Protein: ENSMUSP00000123499
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:TSSC4 159 266 5.2e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136602
AA Change: D25G
Predicted Effect probably benign
Transcript: ENSMUST00000137856
SMART Domains Protein: ENSMUSP00000123353
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 209 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146075
Predicted Effect probably benign
Transcript: ENSMUST00000147995
SMART Domains Protein: ENSMUSP00000122335
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 196 4.8e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148715
AA Change: D93G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150589
Predicted Effect probably benign
Transcript: ENSMUST00000150867
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177841
SMART Domains Protein: ENSMUSP00000137399
Gene: ENSMUSG00000045752

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 210 1.7e-34 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207776
Predicted Effect probably benign
Transcript: ENSMUST00000208779
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Pcnt T C 10: 76,409,500 D1101G probably benign Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Trpm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Trpm5 APN 7 143082991 missense probably benign 0.03
IGL00717:Trpm5 APN 7 143073990 missense probably damaging 1.00
IGL01138:Trpm5 APN 7 143074569 missense probably benign
IGL01590:Trpm5 APN 7 143082734 missense probably damaging 0.99
IGL01603:Trpm5 APN 7 143075601 missense probably benign 0.04
IGL01685:Trpm5 APN 7 143082354 missense probably benign 0.05
IGL01878:Trpm5 APN 7 143074497 missense probably damaging 1.00
IGL02533:Trpm5 APN 7 143089545 missense probably benign 0.01
IGL02572:Trpm5 APN 7 143087876 splice site probably benign
IGL02750:Trpm5 APN 7 143074484 missense possibly damaging 0.89
IGL02862:Trpm5 APN 7 143082525 missense probably damaging 1.00
R0032:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0334:Trpm5 UTSW 7 143086876 missense probably benign 0.06
R0799:Trpm5 UTSW 7 143078351 missense probably damaging 0.99
R1187:Trpm5 UTSW 7 143074469 missense probably damaging 0.96
R1373:Trpm5 UTSW 7 143086842 splice site probably benign
R1521:Trpm5 UTSW 7 143082889 missense probably benign 0.00
R1603:Trpm5 UTSW 7 143085209 missense probably benign 0.00
R1606:Trpm5 UTSW 7 143085171 nonsense probably null
R2009:Trpm5 UTSW 7 143087738 missense possibly damaging 0.58
R2437:Trpm5 UTSW 7 143082561 missense probably benign 0.03
R2508:Trpm5 UTSW 7 143088919 missense possibly damaging 0.80
R2516:Trpm5 UTSW 7 143074517 missense probably damaging 1.00
R2985:Trpm5 UTSW 7 143082938 missense probably damaging 0.99
R3036:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3037:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3688:Trpm5 UTSW 7 143078456 missense probably damaging 0.98
R4156:Trpm5 UTSW 7 143089055 missense probably benign 0.04
R4734:Trpm5 UTSW 7 143082785 missense probably benign 0.04
R4811:Trpm5 UTSW 7 143080219 missense probably damaging 1.00
R4814:Trpm5 UTSW 7 143082636 missense possibly damaging 0.50
R4847:Trpm5 UTSW 7 143087763 missense possibly damaging 0.89
R5055:Trpm5 UTSW 7 143072784 missense probably benign 0.00
R5256:Trpm5 UTSW 7 143082303 missense probably damaging 1.00
R5413:Trpm5 UTSW 7 143080968 missense probably damaging 1.00
R6133:Trpm5 UTSW 7 143088951 missense probably damaging 0.98
R6242:Trpm5 UTSW 7 143073182 missense probably benign
R6564:Trpm5 UTSW 7 143072770 missense probably damaging 1.00
R6702:Trpm5 UTSW 7 143069318 unclassified probably benign
R6703:Trpm5 UTSW 7 143069318 unclassified probably benign
R6829:Trpm5 UTSW 7 143069429 unclassified probably benign
R6940:Trpm5 UTSW 7 143084810 nonsense probably null
R7337:Trpm5 UTSW 7 143089019 missense probably benign 0.01
X0022:Trpm5 UTSW 7 143083042 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTAATGCTACCCACCAGGATG -3'
(R):5'- ATTGCTTGGTGGCCTATTCC -3'

Sequencing Primer
(F):5'- CTTGCCTGTGATTCCAGA -3'
(R):5'- CAATCTCTTTGAGGGTACAGCAG -3'
Posted On2016-11-09