Incidental Mutation 'R5668:Pcnt'
ID442455
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission 043311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5668 (G1)
Quality Score169
Status Validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76409500 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1101 (D1101G)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect probably benign
Transcript: ENSMUST00000001179
AA Change: D1101G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: D1101G

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000217838
AA Change: D1101G

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220395
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,904,550 W429R probably damaging Het
Afg1l C T 10: 42,360,240 C272Y probably damaging Het
Agrn T C 4: 156,167,313 T1831A probably damaging Het
AI481877 A G 4: 59,047,399 S1407P probably benign Het
Aifm2 T C 10: 61,725,917 V14A probably damaging Het
Angptl3 A T 4: 99,032,084 probably null Het
Arfgap1 A T 2: 180,974,119 D197V possibly damaging Het
Atp1a3 T C 7: 24,978,869 probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC067074 A G 13: 113,317,167 S55G possibly damaging Het
Brwd1 T C 16: 96,016,150 I1387M probably damaging Het
Cavin4 A G 4: 48,672,499 T315A probably benign Het
Cep128 T C 12: 90,999,636 T1066A probably benign Het
Cln3 T C 7: 126,572,386 T376A probably benign Het
Cntn4 A T 6: 106,679,436 silent Het
Colec12 T A 18: 9,848,963 D380E probably damaging Het
Csmd3 T C 15: 47,695,755 I2371V possibly damaging Het
Cxcl3 T C 5: 90,787,440 S99P unknown Het
Ddx60 A G 8: 62,000,578 R1244G probably benign Het
Dhx38 T C 8: 109,553,416 D914G probably damaging Het
Dlc1 T G 8: 36,937,501 probably benign Het
Fam161b A G 12: 84,356,350 S169P probably damaging Het
Fastkd1 A G 2: 69,707,381 S286P possibly damaging Het
Fmn2 A T 1: 174,582,037 E612V unknown Het
Foxb1 T A 9: 69,760,246 M1L probably damaging Het
Gm14412 A T 2: 177,315,609 C164* probably null Het
Gm43302 T A 5: 105,275,812 M432L probably benign Het
Gm4353 C A 7: 116,083,678 A223S probably damaging Het
Gm884 T A 11: 103,617,054 probably benign Het
Gm8994 A T 6: 136,329,395 I264F probably benign Het
Gpatch8 T C 11: 102,500,867 K143R unknown Het
Gpr15 A G 16: 58,717,650 S359P probably damaging Het
Gucy2e A G 11: 69,228,381 L649P probably damaging Het
H2-M10.5 C A 17: 36,774,581 H211N probably damaging Het
Hs6st1 T C 1: 36,103,889 Y302H probably damaging Het
Khdrbs2 A T 1: 32,467,770 D165V probably damaging Het
Klra13-ps T G 6: 130,304,283 noncoding transcript Het
Lrrc37a T A 11: 103,500,175 T1475S probably benign Het
Ly75 A G 2: 60,354,500 S437P probably damaging Het
Maz C T 7: 127,025,322 C342Y probably damaging Het
Mcf2l C A 8: 13,013,812 S1008* probably null Het
Mcmbp T C 7: 128,712,754 D246G probably benign Het
Mipol1 G A 12: 57,325,560 R135H possibly damaging Het
Mycbp2 T A 14: 103,120,519 Y4613F possibly damaging Het
Nup188 G A 2: 30,336,324 A1118T probably damaging Het
Olfr1226 A T 2: 89,193,826 D69E possibly damaging Het
Olfr1249 G A 2: 89,630,344 L185F probably damaging Het
Olfr1427 A G 19: 12,098,926 S238P probably damaging Het
Olfr267 T A 4: 58,785,489 I78F probably benign Het
Olfr573-ps1 T C 7: 102,941,921 K219E probably benign Het
Olfr585 A T 7: 103,097,896 S52C probably benign Het
Olfr981 A T 9: 40,022,668 I92F probably damaging Het
P3h1 T A 4: 119,244,046 I460N possibly damaging Het
Phlpp2 C A 8: 109,928,573 Q667K possibly damaging Het
Plec A G 15: 76,190,466 F434L possibly damaging Het
Ppp6r2 T A 15: 89,280,399 I602N probably damaging Het
Rdh8 A C 9: 20,825,179 I181L probably benign Het
Rnf181 A G 6: 72,361,522 M1T probably null Het
Rpl29-ps2 A G 13: 4,614,222 noncoding transcript Het
Sart3 A G 5: 113,745,156 probably null Het
Sec14l2 A C 11: 4,109,189 L160R probably damaging Het
Senp1 C T 15: 98,048,355 R503H probably damaging Het
Slc22a2 T C 17: 12,608,409 V316A probably benign Het
Slc34a1 A T 13: 55,409,085 I365F possibly damaging Het
Spag5 T C 11: 78,304,716 V283A possibly damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Sun3 A G 11: 9,031,433 probably null Het
Syt6 A G 3: 103,620,901 Y312C probably damaging Het
Tas2r121 T A 6: 132,700,793 Y72F possibly damaging Het
Tfrc A G 16: 32,623,376 Y473C probably damaging Het
Trp63 C T 16: 25,866,185 A274V possibly damaging Het
Trpm5 T C 7: 143,073,229 D1085G probably benign Het
Ttn A G 2: 76,914,664 V5347A probably benign Het
Vma21-ps T A 4: 52,496,946 Q100L possibly damaging Het
Vmn2r22 T C 6: 123,637,914 N239S probably benign Het
Wfdc8 T C 2: 164,597,419 probably benign Het
Xkr4 T A 1: 3,671,035 Y105F probably damaging Het
Xpo7 C T 14: 70,682,846 V627I possibly damaging Het
Zfp606 T C 7: 12,492,552 V200A probably benign Het
Zfp936 A T 7: 43,190,434 S441C possibly damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 intron probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTCTGGTTAAGCAGTTTGC -3'
(R):5'- GTGACTCAGATATTAACAAGTTCCCC -3'

Sequencing Primer
(F):5'- GCAGTTTGCTGTTAAAGACCC -3'
(R):5'- ACCCTCTGTATCTTCCTGTATGTAG -3'
Posted On2016-11-09