Incidental Mutation 'R5669:Ttf2'
ID442496
Institutional Source Beutler Lab
Gene Symbol Ttf2
Ensembl Gene ENSMUSG00000033222
Gene Nametranscription termination factor, RNA polymerase II
Synonyms
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100938860-100969663 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 100951117 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 719 (K719*)
Ref Sequence ENSEMBL: ENSMUSP00000076208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076941]
Predicted Effect probably null
Transcript: ENSMUST00000076941
AA Change: K719*
SMART Domains Protein: ENSMUSP00000076208
Gene: ENSMUSG00000033222
AA Change: K719*

DomainStartEndE-ValueType
Pfam:zf-GRF 4 44 2.3e-10 PFAM
low complexity region 328 340 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 458 479 N/A INTRINSIC
DEXDc 542 774 8.6e-35 SMART
Blast:DEXDc 839 892 8e-7 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 917 932 N/A INTRINSIC
HELICc 999 1082 5.61e-16 SMART
low complexity region 1099 1110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145811
Predicted Effect probably benign
Transcript: ENSMUST00000151697
SMART Domains Protein: ENSMUSP00000119032
Gene: ENSMUSG00000033222

DomainStartEndE-ValueType
Blast:DEXDc 21 82 1e-20 BLAST
low complexity region 105 121 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI2/SNF2 family of proteins, which play a critical role in altering protein-DNA interactions. The encoded protein has been shown to have dsDNA-dependent ATPase activity and RNA polymerase II termination activity. This protein interacts with cell division cycle 5-like, associates with human splicing complexes, and plays a role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Ttf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Ttf2 APN 3 100967097 splice site probably benign
IGL01578:Ttf2 APN 3 100956195 missense possibly damaging 0.59
IGL02218:Ttf2 APN 3 100964093 missense possibly damaging 0.61
IGL03267:Ttf2 APN 3 100944804 nonsense probably null
FR4548:Ttf2 UTSW 3 100963160 small insertion probably benign
FR4737:Ttf2 UTSW 3 100963160 small insertion probably benign
R0784:Ttf2 UTSW 3 100962710 missense probably benign 0.01
R0894:Ttf2 UTSW 3 100969549 splice site probably benign
R2083:Ttf2 UTSW 3 100969501 missense probably benign 0.18
R2125:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2126:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2230:Ttf2 UTSW 3 100957944 missense probably damaging 0.99
R3084:Ttf2 UTSW 3 100948264 missense possibly damaging 0.56
R3700:Ttf2 UTSW 3 100951008 missense probably damaging 1.00
R3963:Ttf2 UTSW 3 100941820 unclassified probably benign
R4002:Ttf2 UTSW 3 100948225 nonsense probably null
R4290:Ttf2 UTSW 3 100962761 missense probably benign 0.01
R4833:Ttf2 UTSW 3 100961406 missense probably benign 0.00
R4909:Ttf2 UTSW 3 100954315 missense probably damaging 1.00
R5011:Ttf2 UTSW 3 100963169 missense probably benign 0.14
R5523:Ttf2 UTSW 3 100959242 missense probably damaging 1.00
R6531:Ttf2 UTSW 3 100956260 missense probably damaging 0.99
R6776:Ttf2 UTSW 3 100952553 missense probably benign 0.01
R6795:Ttf2 UTSW 3 100959262 missense probably damaging 1.00
R6861:Ttf2 UTSW 3 100969625 missense possibly damaging 0.89
R6940:Ttf2 UTSW 3 100969515 missense probably damaging 1.00
R6958:Ttf2 UTSW 3 100945932 missense probably benign 0.30
R6962:Ttf2 UTSW 3 100951137 missense probably damaging 1.00
R7211:Ttf2 UTSW 3 100959307 missense probably benign 0.00
R7365:Ttf2 UTSW 3 100963302 missense possibly damaging 0.92
R7470:Ttf2 UTSW 3 100963162 missense possibly damaging 0.85
R7534:Ttf2 UTSW 3 100950412 intron probably null
Predicted Primers PCR Primer
(F):5'- CCTGCCACACAAGATAATCTGG -3'
(R):5'- AATTAGAGGGTCTGAGTGGGCC -3'

Sequencing Primer
(F):5'- GATAATCTGGACACATCAGAGCTC -3'
(R):5'- GGGCCCTCAGGTTATGTTCC -3'
Posted On2016-11-09