Incidental Mutation 'R5669:Retsat'
ID442506
Institutional Source Beutler Lab
Gene Symbol Retsat
Ensembl Gene ENSMUSG00000056666
Gene Nameretinol saturase (all trans retinol 13,14 reductase)
Synonyms
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72598475-72608425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72606010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 176 (S176G)
Ref Sequence ENSEMBL: ENSMUSP00000135421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524] [ENSMUST00000070597] [ENSMUST00000176168] [ENSMUST00000176364]
Predicted Effect probably benign
Transcript: ENSMUST00000070524
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070597
AA Change: S385G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068568
Gene: ENSMUSG00000056666
AA Change: S385G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:FAD_binding_2 68 113 8.9e-9 PFAM
Pfam:NAD_binding_8 71 136 1.3e-15 PFAM
Pfam:Amino_oxidase 76 587 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175824
Predicted Effect probably benign
Transcript: ENSMUST00000176168
AA Change: S176G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135421
Gene: ENSMUSG00000056666
AA Change: S176G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1gpea1 95 175 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176364
AA Change: S324G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134847
Gene: ENSMUSG00000056666
AA Change: S324G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1d5ta1 91 290 7e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000205878
AA Change: S13G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206112
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are deficient in the production of all-trans-13,14-dihydroretinol from dietary vitamin A and exhibit increased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Retsat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Retsat APN 6 72607317 missense probably damaging 1.00
IGL01816:Retsat APN 6 72601605 missense probably benign 0.02
IGL01993:Retsat APN 6 72604995 unclassified probably benign
IGL02212:Retsat APN 6 72601710 nonsense probably null
IGL02719:Retsat APN 6 72603659 missense possibly damaging 0.94
IGL02870:Retsat APN 6 72607024 missense probably damaging 1.00
IGL03352:Retsat APN 6 72598683 missense probably damaging 0.96
R0135:Retsat UTSW 6 72602772 missense probably damaging 0.99
R0487:Retsat UTSW 6 72606431 missense probably damaging 0.96
R1173:Retsat UTSW 6 72603651 unclassified probably benign
R1716:Retsat UTSW 6 72606080 missense probably damaging 0.99
R1718:Retsat UTSW 6 72602671 missense probably benign 0.00
R1744:Retsat UTSW 6 72606575 nonsense probably null
R4976:Retsat UTSW 6 72601626 missense probably damaging 1.00
R5434:Retsat UTSW 6 72601535 missense probably damaging 0.96
R6247:Retsat UTSW 6 72604935 missense probably benign 0.06
R6675:Retsat UTSW 6 72601689 missense probably benign 0.00
R7200:Retsat UTSW 6 72606019 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGTCTCTGCCAGGATCCTATAG -3'
(R):5'- TCTCATTCCTAGAACCGTGTGG -3'

Sequencing Primer
(F):5'- CTCTGCCAGGATCCTATAGAAATAG -3'
(R):5'- CCTAGAACCGTGTGGAGGGTG -3'
Posted On2016-11-09