Incidental Mutation 'R5669:Ddx42'
ID442524
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 42
SynonymsB430002H05Rik, SF3b125, 1810047H21Rik
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106216926-106249139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106241819 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 556 (D556V)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046]
Predicted Effect probably damaging
Transcript: ENSMUST00000021046
AA Change: D556V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: D556V

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152860
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106235749 missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106231178 missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106247499 missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106248029 missense probably benign 0.00
IGL01715:Ddx42 APN 11 106224275 missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106239160 missense probably benign 0.00
IGL03182:Ddx42 APN 11 106247527 missense probably benign
P0045:Ddx42 UTSW 11 106231272 missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106247849 missense probably benign 0.03
R0646:Ddx42 UTSW 11 106232833 missense probably benign 0.00
R2277:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106231150 missense possibly damaging 0.56
R2519:Ddx42 UTSW 11 106245329 missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106247810 missense probably benign 0.00
R3498:Ddx42 UTSW 11 106231193 missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106247692 missense probably benign 0.03
R4421:Ddx42 UTSW 11 106231138 missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106247703 missense probably benign 0.09
R4953:Ddx42 UTSW 11 106242940 missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106224898 missense probably benign
R6091:Ddx42 UTSW 11 106234970 missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106240017 missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106228820 missense probably benign 0.14
R6991:Ddx42 UTSW 11 106239144 missense probably damaging 1.00
R7351:Ddx42 UTSW 11 106247682 missense probably benign
R7502:Ddx42 UTSW 11 106247739 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGAACTGGCTGACTCG -3'
(R):5'- GACATGAGGGCATAACTGTTCC -3'

Sequencing Primer
(F):5'- ACTTCCTCGGGGAGTGTGC -3'
(R):5'- GAGGGCATAACTGTTCCCCTCAAG -3'
Posted On2016-11-09