Incidental Mutation 'R5669:Tmprss6'
ID442539
Institutional Source Beutler Lab
Gene Symbol Tmprss6
Ensembl Gene ENSMUSG00000016942
Gene Nametransmembrane serine protease 6
Synonymsmatriptase-2, 1300008A22Rik
MMRRC Submission 043312-MU
Accession Numbers

ENSMUST00000017086; MGI: 1919003

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78439667-78468634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78454956 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 262 (M262K)
Ref Sequence ENSEMBL: ENSMUSP00000155401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000229124] [ENSMUST00000229516] [ENSMUST00000230159] [ENSMUST00000230226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017086
AA Change: M274K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942
AA Change: M274K

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229124
Predicted Effect possibly damaging
Transcript: ENSMUST00000229516
AA Change: M274K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230159
AA Change: M274K

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230226
AA Change: M262K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(6) Gene trapped(2) Chemically induced(3)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Aldh1a1 T C 19: 20,610,920 I25T probably damaging Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Tmprss6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably null 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.99
cubone UTSW 15 78446657 splice site probably null
ekans UTSW 15 78459427 splice site probably null
mask UTSW 15 78464455 intron probably benign
masquerade UTSW 15 78468000 intron probably benign
zorro UTSW 15 78464552 intron probably benign
PIT1430001:Tmprss6 UTSW 15 78440627 missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78452868 missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 splice site probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78459427 splice site probably null
R4344:Tmprss6 UTSW 15 78459427 splice site probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably damaging 1.00
R4859:Tmprss6 UTSW 15 78446677 missense probably damaging 0.99
R4869:Tmprss6 UTSW 15 78443680 unclassified probably null
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense probably damaging 0.99
R5225:Tmprss6 UTSW 15 78452507 missense probably damaging 0.97
R5569:Tmprss6 UTSW 15 78440303 missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5947:Tmprss6 UTSW 15 78452522 missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78440257 missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78446777 missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78443817 missense unknown
R7338:Tmprss6 UTSW 15 78459819 missense probably damaging 1.00
X0025:Tmprss6 UTSW 15 78455095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCACACAACCTTGTAGCCTC -3'
(R):5'- TGCTACCATGGCTGGAGAAG -3'

Sequencing Primer
(F):5'- ACACAACCTTGTAGCCTCCCTTC -3'
(R):5'- TCTGGCTAAGGGCTCTGTCC -3'
Posted On2016-11-09