Incidental Mutation 'R5669:Aldh1a1'
ID442541
Institutional Source Beutler Lab
Gene Symbol Aldh1a1
Ensembl Gene ENSMUSG00000053279
Gene Namealdehyde dehydrogenase family 1, subfamily A1
SynonymsAhd-2, Ahd2, ALDH1, Raldh1, E1
MMRRC Submission 043312-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R5669 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location20492715-20643462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20610920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 25 (I25T)
Ref Sequence ENSEMBL: ENSMUSP00000153410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087638] [ENSMUST00000225313] [ENSMUST00000225337]
Predicted Effect probably damaging
Transcript: ENSMUST00000087638
AA Change: I25T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084918
Gene: ENSMUSG00000053279
AA Change: I25T

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 5.1e-185 PFAM
Pfam:LuxC 147 368 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225313
AA Change: I25T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225337
AA Change: I25T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene show a significantly reduced ability to convert retinol to retinoic acid in the liver. Retinal morphology is normal even though the gene is normally highly expressed in the dorsal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Akap9 T A 5: 4,050,540 L2734* probably null Het
Astl G T 2: 127,347,279 R175L probably damaging Het
BC035947 A T 1: 78,497,913 C661S probably damaging Het
Cd160 C T 3: 96,808,898 probably benign Het
Cdc42bpb C T 12: 111,302,013 probably null Het
Cdip1 T A 16: 4,768,815 I149F probably damaging Het
Cfap65 T C 1: 74,924,968 Y607C probably damaging Het
Col6a5 A G 9: 105,925,998 I1256T unknown Het
Copb1 A G 7: 114,237,585 V336A probably damaging Het
Ddx42 A T 11: 106,241,819 D556V probably damaging Het
Dlk1 T C 12: 109,460,038 V279A probably benign Het
Fbll1 T C 11: 35,797,584 N284S probably benign Het
Fbxw21 A T 9: 109,145,510 I314N probably benign Het
Foxa3 T C 7: 19,014,251 T317A probably benign Het
Gm14139 A G 2: 150,192,178 I140V probably benign Het
Gpr37 A T 6: 25,669,352 C498S probably benign Het
Hapln3 G T 7: 79,117,496 probably null Het
Igkv4-54 A G 6: 69,631,848 V29A possibly damaging Het
Itgb8 T A 12: 119,190,628 I225F probably damaging Het
Kcnk3 A G 5: 30,622,349 T248A probably damaging Het
Kcnv1 T C 15: 45,114,252 Q130R possibly damaging Het
Lrp1b T C 2: 41,111,038 H2058R probably damaging Het
Macf1 T A 4: 123,476,225 E1581V probably damaging Het
Mga A G 2: 119,903,426 N252D probably damaging Het
Nadsyn1 C T 7: 143,807,431 G335S probably damaging Het
Olfr1115 T C 2: 87,252,441 V168A probably benign Het
Olfr58 T C 9: 19,783,757 F208S probably benign Het
Pak7 G A 2: 136,116,284 P295S probably damaging Het
Pcsk1 T A 13: 75,130,102 S595T probably benign Het
Pepd T C 7: 35,040,674 V324A probably benign Het
Pml C T 9: 58,247,063 D176N probably benign Het
Popdc3 T A 10: 45,316,433 I163N probably damaging Het
Ppp1r13l A C 7: 19,373,022 T481P probably benign Het
Pramef12 T C 4: 144,395,843 I44V probably benign Het
Prlh A G 1: 90,953,120 T5A probably benign Het
Prom1 A G 5: 44,012,943 F638S possibly damaging Het
Prpf8 T A 11: 75,504,738 L1897H probably damaging Het
Ret T C 6: 118,184,243 T91A probably benign Het
Retsat A G 6: 72,606,010 S176G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,458,785 L3823P possibly damaging Het
Rnf31 C T 14: 55,596,704 A653V probably damaging Het
Rps6kl1 T C 12: 85,147,867 D90G probably damaging Het
Scarb1 A G 5: 125,300,387 Y194H probably damaging Het
Scube2 C T 7: 109,825,439 A556T probably benign Het
Serpinb1a A G 13: 32,845,316 L243P probably damaging Het
Slc39a4 A C 15: 76,614,163 L358R probably damaging Het
Slitrk5 A G 14: 111,681,623 D893G probably damaging Het
Srgap1 C A 10: 121,804,850 V681L probably benign Het
Tmprss6 A T 15: 78,454,956 M262K possibly damaging Het
Ttf2 T A 3: 100,951,117 K719* probably null Het
Vmn1r62 T A 7: 5,675,737 L139* probably null Het
Other mutations in Aldh1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aldh1a1 APN 19 20619997 missense probably benign 0.13
IGL01769:Aldh1a1 APN 19 20642919 missense probably benign 0.29
IGL02745:Aldh1a1 APN 19 20636664 splice site probably benign
IGL02989:Aldh1a1 APN 19 20640058 splice site probably benign
IGL03154:Aldh1a1 APN 19 20630768 missense probably benign 0.21
LCD18:Aldh1a1 UTSW 19 20626646 intron probably benign
R0265:Aldh1a1 UTSW 19 20640076 nonsense probably null
R0282:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0418:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0471:Aldh1a1 UTSW 19 20602013 start codon destroyed probably null 0.99
R0556:Aldh1a1 UTSW 19 20634478 missense probably damaging 1.00
R0755:Aldh1a1 UTSW 19 20617994 missense probably benign
R1164:Aldh1a1 UTSW 19 20617946 missense probably benign 0.11
R1692:Aldh1a1 UTSW 19 20630818 missense probably damaging 1.00
R1905:Aldh1a1 UTSW 19 20617998 missense probably damaging 1.00
R2127:Aldh1a1 UTSW 19 20642915 missense probably benign 0.00
R2281:Aldh1a1 UTSW 19 20620091 missense possibly damaging 0.88
R2475:Aldh1a1 UTSW 19 20640078 missense probably benign
R3871:Aldh1a1 UTSW 19 20624753 nonsense probably null
R4607:Aldh1a1 UTSW 19 20621687 missense probably benign 0.35
R4725:Aldh1a1 UTSW 19 20640081 missense probably benign
R4791:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4792:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4844:Aldh1a1 UTSW 19 20634400 missense probably benign 0.00
R5639:Aldh1a1 UTSW 19 20623422 missense probably damaging 1.00
R5815:Aldh1a1 UTSW 19 20630670 missense probably benign 0.00
R6387:Aldh1a1 UTSW 19 20617959 missense probably damaging 0.99
R7078:Aldh1a1 UTSW 19 20602070 missense probably benign
R7282:Aldh1a1 UTSW 19 20629070 missense possibly damaging 0.68
R7334:Aldh1a1 UTSW 19 20621711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGACTGTGGGACCAAAG -3'
(R):5'- CATGTCTTTCATTGAACTCGTAGTG -3'

Sequencing Primer
(F):5'- TTTTACTGTGCACAAAGGAGTG -3'
(R):5'- TGAGTGAGCTCATAACGGTG -3'
Posted On2016-11-09