Incidental Mutation 'R5670:Trim24'
ID442570
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Nametripartite motif-containing 24
SynonymsA130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location37870811-37966296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37965601 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 946 (F946S)
Ref Sequence ENSEMBL: ENSMUSP00000114001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
Predicted Effect probably benign
Transcript: ENSMUST00000031859
AA Change: F1016S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: F1016S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120238
AA Change: F946S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: F946S

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120428
AA Change: F982S

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: F982S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Gm4787 G A 12: 81,378,031 T451I probably benign Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P possibly damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37903648 missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37965635 missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37945613 missense probably benign
IGL02525:Trim24 APN 6 37945718 missense probably damaging 0.99
IGL02557:Trim24 APN 6 37965499 critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37960784 missense probably damaging 1.00
IGL02795:Trim24 APN 6 37919389 missense probably damaging 1.00
IGL02877:Trim24 APN 6 37965646 missense probably damaging 1.00
IGL02889:Trim24 APN 6 37957761 missense probably benign 0.02
IGL02930:Trim24 APN 6 37951445 splice site probably benign
IGL03076:Trim24 APN 6 37965632 missense probably damaging 0.98
Lithe UTSW 6 37958569 missense probably damaging 1.00
Nervous UTSW 6 37957729 missense probably damaging 1.00
pliant UTSW 6 37919491 critical splice donor site probably null
qualmish UTSW 6 37903652 critical splice donor site probably null
Queasy UTSW 6 37908305 missense probably damaging 0.99
squeamish UTSW 6 37915202 nonsense probably null
Uneasy UTSW 6 37956477 critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37900732 critical splice donor site probably null
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0183:Trim24 UTSW 6 37943480 missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37915195 missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37957066 missense probably damaging 1.00
R0606:Trim24 UTSW 6 37871234 missense probably benign
R0609:Trim24 UTSW 6 37957783 missense probably damaging 1.00
R0637:Trim24 UTSW 6 37958559 splice site probably null
R0734:Trim24 UTSW 6 37919465 missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37915202 nonsense probably null
R1131:Trim24 UTSW 6 37957782 missense probably damaging 1.00
R1141:Trim24 UTSW 6 37915293 missense probably damaging 1.00
R1159:Trim24 UTSW 6 37956477 critical splice donor site probably null
R1460:Trim24 UTSW 6 37964826 missense probably damaging 1.00
R1672:Trim24 UTSW 6 37915279 missense probably damaging 1.00
R1868:Trim24 UTSW 6 37951512 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1894:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1913:Trim24 UTSW 6 37957815 missense probably damaging 1.00
R2254:Trim24 UTSW 6 37958677 missense probably benign
R2511:Trim24 UTSW 6 37903652 critical splice donor site probably null
R2849:Trim24 UTSW 6 37956453 missense probably damaging 0.99
R3878:Trim24 UTSW 6 37964773 missense probably benign 0.14
R4084:Trim24 UTSW 6 37915257 missense probably damaging 1.00
R4235:Trim24 UTSW 6 37964740 missense probably damaging 1.00
R4292:Trim24 UTSW 6 37900692 missense possibly damaging 0.91
R4633:Trim24 UTSW 6 37956436 missense probably damaging 0.98
R4651:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4652:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4686:Trim24 UTSW 6 37908305 missense probably damaging 0.99
R5000:Trim24 UTSW 6 37958612 missense probably benign 0.01
R5213:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R5258:Trim24 UTSW 6 37919400 missense probably damaging 0.99
R5292:Trim24 UTSW 6 37903604 missense probably benign 0.23
R5395:Trim24 UTSW 6 37957744 missense probably damaging 1.00
R5547:Trim24 UTSW 6 37965550 missense probably damaging 1.00
R5666:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5849:Trim24 UTSW 6 37957729 missense probably damaging 1.00
R5927:Trim24 UTSW 6 37958569 missense probably damaging 1.00
R5932:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R6286:Trim24 UTSW 6 37919491 critical splice donor site probably null
R6374:Trim24 UTSW 6 37953549 missense probably benign 0.12
R6449:Trim24 UTSW 6 37903652 critical splice donor site probably null
R6723:Trim24 UTSW 6 37951468 missense probably benign 0.00
R6731:Trim24 UTSW 6 37943485 missense probably damaging 0.99
R6975:Trim24 UTSW 6 37919492 critical splice donor site probably null
R7000:Trim24 UTSW 6 37958678 missense probably benign 0.24
R7126:Trim24 UTSW 6 37919457 missense probably damaging 1.00
R7162:Trim24 UTSW 6 37965521 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCATTACAAGTTTCATAGTCGTGTGC -3'
(R):5'- GATCACTGACAAGCCTTTTGC -3'

Sequencing Primer
(F):5'- TCATAGTCGTGTGCAAAATAGGAAC -3'
(R):5'- GCTGTCTTTAGTTTTGATGAGAAATC -3'
Posted On2016-11-09