Incidental Mutation 'R5670:Gm4787'
ID442592
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission 043313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5670 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81378031 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 451 (T451I)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: T451I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T451I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik T C 5: 99,979,209 probably benign Het
Ahsg T A 16: 22,898,163 N158K probably benign Het
Arhgef10 T C 8: 14,954,774 M430T probably benign Het
Bmper T A 9: 23,473,463 M588K probably damaging Het
Btla A T 16: 45,250,419 D247V probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cap2 T A 13: 46,531,083 probably null Het
Chd2 A T 7: 73,441,717 I1592K probably benign Het
Col4a4 A G 1: 82,485,579 probably null Het
Copg1 C T 6: 87,912,235 T853M probably damaging Het
Ddb2 C T 2: 91,212,581 V353M probably damaging Het
Dip2b A G 15: 100,190,104 D973G possibly damaging Het
Dscam G A 16: 96,718,164 T791I probably benign Het
Dtd2 T A 12: 51,999,860 L65F probably damaging Het
Fer1l6 C T 15: 58,622,482 P1175S probably benign Het
Fzd6 A T 15: 39,031,115 R225S probably benign Het
Glce A G 9: 62,060,511 S453P probably damaging Het
Gm38100 C T 1: 175,921,613 T415M probably damaging Het
Igkv8-18 C T 6: 70,356,149 T25I probably benign Het
Ikzf2 A G 1: 69,577,900 V96A probably benign Het
Ilkap T C 1: 91,391,141 T38A probably benign Het
Lpin3 A G 2: 160,897,330 T353A probably benign Het
Mfsd8 A T 3: 40,822,049 N389K probably benign Het
Mttp A T 3: 138,125,113 V65D probably damaging Het
Ndufaf4 A T 4: 24,898,636 D64V probably damaging Het
Nfe2l2 T C 2: 75,677,118 T213A probably benign Het
Nkain4 A G 2: 180,943,202 L73P probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1271 T C 2: 90,265,964 I155M probably benign Het
Olfr1389 T G 11: 49,431,208 L244R probably damaging Het
Olfr173 G A 16: 58,797,061 P262S possibly damaging Het
Olfr365 T A 2: 37,201,994 V251D probably benign Het
Pdgfra T C 5: 75,173,495 S410P probably benign Het
Phldb1 T C 9: 44,715,781 M456V probably damaging Het
Pi16 C T 17: 29,326,896 T216I probably damaging Het
Plekha2 C A 8: 25,059,238 A177S probably benign Het
Prss16 C T 13: 22,003,051 V450I possibly damaging Het
Rab3gap2 C T 1: 185,221,899 P56L probably benign Het
Rab3gap2 T A 1: 185,277,205 L1086H probably damaging Het
Rgs21 A G 1: 144,536,942 V48A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 A G 11: 119,434,686 probably null Het
Slc4a2 G T 5: 24,434,838 V506L probably damaging Het
Sptbn5 C G 2: 120,085,567 probably benign Het
Steap2 C T 5: 5,673,681 V400I probably benign Het
Syne2 G A 12: 75,950,959 G2236D probably benign Het
Tespa1 T C 10: 130,354,755 S84P possibly damaging Het
Tlx2 G A 6: 83,069,826 A85V possibly damaging Het
Tm4sf1 A T 3: 57,293,087 F65I probably benign Het
Tmprss13 A G 9: 45,344,955 I456V probably damaging Het
Tpte C T 8: 22,327,748 S250F probably damaging Het
Trim24 T C 6: 37,965,601 F946S probably benign Het
Vmn2r10 A T 5: 108,999,044 Y459* probably null Het
Vps54 T A 11: 21,264,864 I112N probably damaging Het
Vwa1 A G 4: 155,774,465 L13P probably damaging Het
Zfp648 C A 1: 154,204,217 Q41K probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACACTGCAAATGACGGTC -3'
(R):5'- TGCTACATATGAGGATCCATGG -3'

Sequencing Primer
(F):5'- GCAAATGACGGTCAGTACAGTTTCC -3'
(R):5'- ACATATGAGGATCCATGGTTGGGATC -3'
Posted On2016-11-09