Incidental Mutation 'R5671:Clca4b'
ID442608
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission 043314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5671 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144921863 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 449 (T449I)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably benign
Transcript: ENSMUST00000098549
AA Change: T449I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: T449I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
A530099J19Rik A G 13: 19,729,295 noncoding transcript Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 T A 6: 85,629,208 N2613K possibly damaging Het
Antxr1 C T 6: 87,217,273 probably null Het
Ap3b1 A T 13: 94,528,257 R901S unknown Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Cdx1 C T 18: 61,019,899 V212I probably benign Het
Clec14a T C 12: 58,267,826 I337V probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Golga7 C T 8: 23,250,344 A57T probably damaging Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Igkv9-120 G A 6: 68,050,273 W57* probably null Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nhlrc1 A G 13: 47,013,717 F355L probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Olfr1444 A T 19: 12,861,807 T11S probably benign Het
Pcsk1 A G 13: 75,097,907 T135A possibly damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rbbp8 A G 18: 11,742,642 S871G probably benign Het
Rhoj A T 12: 75,393,969 I135F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ska1 G T 18: 74,196,996 D224E probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a28 A T 19: 8,131,431 C116S probably damaging Het
Synpo T C 18: 60,595,950 D1060G probably damaging Het
Tectb T C 19: 55,192,627 S310P probably benign Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Tpo A G 12: 30,119,491 S82P probably benign Het
Ttyh3 T A 5: 140,631,552 M321L probably benign Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Vmn2r11 A G 5: 109,054,906 W102R probably benign Het
Vps13a G A 19: 16,715,100 H817Y probably benign Het
Vps51 A G 19: 6,068,194 V757A probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Zfp423 T C 8: 87,782,327 N442S probably damaging Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTCTTTTCCAGCCAACTG -3'
(R):5'- TCCATCAGGACAGCTAATCTAGTATG -3'

Sequencing Primer
(F):5'- CAGCCAACTGGAAAGAGAATGTGATG -3'
(R):5'- TGGTATTCTAAATTATGCTTGCAGG -3'
Posted On2016-11-09