Incidental Mutation 'R5671:Igkv9-120'
ID442616
Institutional Source Beutler Lab
Gene Symbol Igkv9-120
Ensembl Gene ENSMUSG00000094872
Gene Nameimmunoglobulin kappa chain variable 9-120
SynonymsGm5571
MMRRC Submission 043314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5671 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location68049983-68050454 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 68050273 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 57 (W57*)
Ref Sequence ENSEMBL: ENSMUSP00000100117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103316]
Predicted Effect probably null
Transcript: ENSMUST00000103316
AA Change: W57*
SMART Domains Protein: ENSMUSP00000100117
Gene: ENSMUSG00000094872
AA Change: W57*

DomainStartEndE-ValueType
IGv 40 112 9.99e-13 SMART
Meta Mutation Damage Score 0.6348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
A530099J19Rik A G 13: 19,729,295 noncoding transcript Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 T A 6: 85,629,208 N2613K possibly damaging Het
Antxr1 C T 6: 87,217,273 probably null Het
Ap3b1 A T 13: 94,528,257 R901S unknown Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Cdx1 C T 18: 61,019,899 V212I probably benign Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clec14a T C 12: 58,267,826 I337V probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Golga7 C T 8: 23,250,344 A57T probably damaging Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nhlrc1 A G 13: 47,013,717 F355L probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Olfr1444 A T 19: 12,861,807 T11S probably benign Het
Pcsk1 A G 13: 75,097,907 T135A possibly damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rbbp8 A G 18: 11,742,642 S871G probably benign Het
Rhoj A T 12: 75,393,969 I135F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ska1 G T 18: 74,196,996 D224E probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a28 A T 19: 8,131,431 C116S probably damaging Het
Synpo T C 18: 60,595,950 D1060G probably damaging Het
Tectb T C 19: 55,192,627 S310P probably benign Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Tpo A G 12: 30,119,491 S82P probably benign Het
Ttyh3 T A 5: 140,631,552 M321L probably benign Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Vmn2r11 A G 5: 109,054,906 W102R probably benign Het
Vps13a G A 19: 16,715,100 H817Y probably benign Het
Vps51 A G 19: 6,068,194 V757A probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Zfp423 T C 8: 87,782,327 N442S probably damaging Het
Other mutations in Igkv9-120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Igkv9-120 APN 6 68049987 missense possibly damaging 0.67
IGL02248:Igkv9-120 APN 6 68050237 missense probably damaging 1.00
IGL02410:Igkv9-120 APN 6 68050043 splice site probably benign
IGL03093:Igkv9-120 APN 6 68050414 missense probably damaging 1.00
R2847:Igkv9-120 UTSW 6 68050144 splice site probably benign
R2848:Igkv9-120 UTSW 6 68050144 splice site probably benign
R3749:Igkv9-120 UTSW 6 68050001 missense probably benign 0.04
R3889:Igkv9-120 UTSW 6 68050378 missense probably damaging 1.00
R4235:Igkv9-120 UTSW 6 68050333 missense probably benign
R4270:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4760:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4767:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4768:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R4769:Igkv9-120 UTSW 6 68050367 missense possibly damaging 0.46
R5365:Igkv9-120 UTSW 6 68050449 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGTTCCACTGTGGTTAGTG -3'
(R):5'- TTGTATCACTGTGGGAGGAGAAC -3'

Sequencing Primer
(F):5'- TCCACTGTGGTTAGTGTTGAC -3'
(R):5'- CTGTGGGAGGAGAACTAGCATATTG -3'
Posted On2016-11-09