Mutagenetix > Incidental Mutation

Incidental Mutation 'R5671:2700049A03Rik'

442632

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3, Ta3

MMRRC Submission

043314-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5671 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71183622-71290077 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71211321 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 685 (E685V)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

AlphaFold

E9PV87

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045907
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685V

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149564
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685V

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Meta Mutation Damage Score

0.1812

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak2	T	A	4: 128,902,040 (GRCm39)	F238I	probably damaging	Het
Akap8l	T	C	17: 32,557,266 (GRCm39)	Y115C	probably damaging	Het
Alms1	T	A	6: 85,606,190 (GRCm39)	N2613K	possibly damaging	Het
Antxr1	C	T	6: 87,194,255 (GRCm39)		probably null	Het
Ap3b1	A	T	13: 94,664,765 (GRCm39)	R901S	unknown	Het
Arhgap45	A	G	10: 79,861,310 (GRCm39)	E491G	probably damaging	Het
Capn11	C	T	17: 45,950,600 (GRCm39)	R293Q	possibly damaging	Het
Cdx1	C	T	18: 61,152,971 (GRCm39)	V212I	probably benign	Het
Clca4b	G	A	3: 144,627,624 (GRCm39)	T449I	probably benign	Het
Clec14a	T	C	12: 58,314,612 (GRCm39)	I337V	probably benign	Het
Clip4	A	C	17: 72,096,878 (GRCm39)	M1L	probably damaging	Het
Exoc3l4	T	C	12: 111,389,851 (GRCm39)	I142T	probably damaging	Het
Flnb	T	A	14: 7,890,843 (GRCm38)	I575N	probably benign	Het
Gad1-ps	A	T	10: 99,280,395 (GRCm39)		noncoding transcript	Het
Golga7	C	T	8: 23,740,360 (GRCm39)	A57T	probably damaging	Het
Gpa33	A	G	1: 165,974,360 (GRCm39)	T66A	possibly damaging	Het
Gpr141b	A	G	13: 19,913,465 (GRCm39)		noncoding transcript	Het
Gpr45	A	G	1: 43,072,218 (GRCm39)	Y287C	probably damaging	Het
H2-Eb1	C	A	17: 34,533,229 (GRCm39)	Y150*	probably null	Het
Hsd17b8	T	C	17: 34,245,435 (GRCm39)	D233G	probably null	Het
Ifna6	A	T	4: 88,745,906 (GRCm39)	Q85L	probably damaging	Het
Igkv9-120	G	A	6: 68,027,257 (GRCm39)	W57*	probably null	Het
Ivns1abp	G	T	1: 151,229,760 (GRCm39)	L149F	probably benign	Het
Kank4	A	G	4: 98,653,698 (GRCm39)		probably null	Het
Lama2	A	T	10: 27,066,540 (GRCm39)	C1114S	probably damaging	Het
Lmbr1l	A	C	15: 98,805,489 (GRCm39)	D337E	possibly damaging	Het
Ly75	T	C	2: 60,138,655 (GRCm39)	D1404G	probably damaging	Het
Muc4	A	G	16: 32,575,011 (GRCm39)	T1199A	probably benign	Het
Nalcn	A	G	14: 123,532,818 (GRCm39)	I1314T	probably damaging	Het
Nhlrc1	A	G	13: 47,167,193 (GRCm39)	F355L	probably benign	Het
Or2y16	T	C	11: 49,335,140 (GRCm39)	V154A	probably benign	Het
Or4k39	C	T	2: 111,238,818 (GRCm39)		noncoding transcript	Het
Or5b21	A	T	19: 12,839,171 (GRCm39)	T11S	probably benign	Het
Pcsk1	A	G	13: 75,246,026 (GRCm39)	T135A	possibly damaging	Het
Ptpru	T	A	4: 131,547,501 (GRCm39)	Y112F	possibly damaging	Het
Rbbp8	A	G	18: 11,875,699 (GRCm39)	S871G	probably benign	Het
Rhoj	A	T	12: 75,440,743 (GRCm39)	I135F	probably damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Semp2l2b	T	A	10: 21,942,742 (GRCm39)	T413S	possibly damaging	Het
Ska1	G	T	18: 74,330,067 (GRCm39)	D224E	probably damaging	Het
Slc11a2	A	G	15: 100,301,169 (GRCm39)	Y295H	probably damaging	Het
Slc22a28	A	T	19: 8,108,795 (GRCm39)	C116S	probably damaging	Het
Synpo	T	C	18: 60,729,022 (GRCm39)	D1060G	probably damaging	Het
Tectb	T	C	19: 55,181,059 (GRCm39)	S310P	probably benign	Het
Tmc6	A	G	11: 117,666,441 (GRCm39)	S288P	possibly damaging	Het
Tpo	A	G	12: 30,169,490 (GRCm39)	S82P	probably benign	Het
Ttyh3	T	A	5: 140,617,307 (GRCm39)	M321L	probably benign	Het
Usp8	A	G	2: 126,584,345 (GRCm39)	D518G	probably benign	Het
Vmn2r11	A	G	5: 109,202,772 (GRCm39)	W102R	probably benign	Het
Vps13a	G	A	19: 16,692,464 (GRCm39)	H817Y	probably benign	Het
Vps51	A	G	19: 6,118,224 (GRCm39)	V757A	probably benign	Het
Washc4	T	C	10: 83,405,892 (GRCm39)	S463P	probably damaging	Het
Zfp423	T	C	8: 88,508,955 (GRCm39)	N442S	probably damaging	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71,213,893 (GRCm39)	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71,241,242 (GRCm39)	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71,211,152 (GRCm39)	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71,213,957 (GRCm39)	missense	probably benign	0.00
IGL01835:2700049A03Rik	APN	12	71,213,955 (GRCm39)	nonsense	probably null
IGL02122:2700049A03Rik	APN	12	71,217,299 (GRCm39)	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71,195,034 (GRCm39)	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71,201,630 (GRCm39)	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71,240,147 (GRCm39)	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71,187,657 (GRCm39)	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71,205,599 (GRCm39)	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71,184,683 (GRCm39)	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71,207,160 (GRCm39)	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71,217,440 (GRCm39)	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71,224,692 (GRCm39)	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71,213,924 (GRCm39)	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71,195,194 (GRCm39)	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71,184,804 (GRCm39)	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71,240,084 (GRCm39)	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71,211,162 (GRCm39)	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71,224,642 (GRCm39)	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71,205,657 (GRCm39)	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71,266,082 (GRCm39)	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71,262,918 (GRCm39)	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71,217,361 (GRCm39)	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71,197,033 (GRCm39)	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71,265,995 (GRCm39)	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71,197,018 (GRCm39)	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71,207,186 (GRCm39)	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71,235,393 (GRCm39)	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2337:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2512:2700049A03Rik	UTSW	12	71,219,945 (GRCm39)	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71,201,530 (GRCm39)	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3236:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71,195,037 (GRCm39)	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4735:2700049A03Rik	UTSW	12	71,262,897 (GRCm39)	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71,236,216 (GRCm39)	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4852:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71,236,420 (GRCm39)	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71,289,799 (GRCm39)	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,240,123 (GRCm39)	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71,235,565 (GRCm39)	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71,289,801 (GRCm39)	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5502:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5725:2700049A03Rik	UTSW	12	71,240,093 (GRCm39)	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71,203,893 (GRCm39)	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71,231,304 (GRCm39)	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71,234,200 (GRCm39)	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71,217,410 (GRCm39)	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71,211,318 (GRCm39)	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71,263,004 (GRCm39)	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71,262,831 (GRCm39)	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71,265,963 (GRCm39)	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71,187,680 (GRCm39)	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71,236,348 (GRCm39)	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71,197,179 (GRCm39)	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71,211,180 (GRCm39)	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71,219,903 (GRCm39)	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71,188,895 (GRCm39)	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71,184,815 (GRCm39)	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71,236,356 (GRCm39)	missense	possibly damaging	0.71
R8852:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R8860:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R9039:2700049A03Rik	UTSW	12	71,213,849 (GRCm39)	missense	possibly damaging	0.51
R9281:2700049A03Rik	UTSW	12	71,205,687 (GRCm39)	missense	possibly damaging	0.51
R9308:2700049A03Rik	UTSW	12	71,231,233 (GRCm39)	missense	probably benign	0.23
R9385:2700049A03Rik	UTSW	12	71,207,966 (GRCm39)	missense	possibly damaging	0.52
R9412:2700049A03Rik	UTSW	12	71,235,457 (GRCm39)	missense	possibly damaging	0.71
R9643:2700049A03Rik	UTSW	12	71,211,189 (GRCm39)	missense	possibly damaging	0.92
R9676:2700049A03Rik	UTSW	12	71,207,905 (GRCm39)	missense	possibly damaging	0.86
R9776:2700049A03Rik	UTSW	12	71,235,448 (GRCm39)	missense	possibly damaging	0.71
R9789:2700049A03Rik	UTSW	12	71,231,357 (GRCm39)	missense	probably benign
Z1177:2700049A03Rik	UTSW	12	71,211,258 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- CTGTTCCCTGGCAGATAACG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'

Posted On

2016-11-09