Incidental Mutation 'R5672:Serpinb9b'
ID442688
Institutional Source Beutler Lab
Gene Symbol Serpinb9b
Ensembl Gene ENSMUSG00000021403
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9b
Synonyms1600019A21Rik, Spi10, ovalbumin, SPI-CI, R86
MMRRC Submission 043174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5672 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33027416-33041884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33039599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000006392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006392]
Predicted Effect probably benign
Transcript: ENSMUST00000006392
AA Change: D258G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000006392
Gene: ENSMUSG00000021403
AA Change: D258G

DomainStartEndE-ValueType
SERPIN 13 377 7.86e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220566
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,763,927 T67A probably benign Het
A4gnt A G 9: 99,620,330 N181S possibly damaging Het
Abcf3 A T 16: 20,549,252 Q74L probably benign Het
Ankrd13c T C 3: 157,961,027 probably null Het
Bub1 A G 2: 127,804,880 F827L possibly damaging Het
Cyp2c55 A G 19: 39,035,546 I355V probably benign Het
Dido1 A G 2: 180,671,903 S319P probably damaging Het
Efna5 A T 17: 62,881,030 V34D probably damaging Het
Fam131a G T 16: 20,699,639 E88D probably damaging Het
Fsip2 A T 2: 82,987,494 R4524* probably null Het
Gm6899 C T 11: 26,593,484 probably benign Het
Iqcg C T 16: 33,019,508 R356Q probably damaging Het
Itgae T A 11: 73,145,551 I1105N possibly damaging Het
Klb T C 5: 65,379,949 I874T possibly damaging Het
Klc3 T C 7: 19,396,331 Y307C probably damaging Het
Lrp1b T A 2: 41,341,759 H378L probably benign Het
Mxd4 G A 5: 34,177,700 R114C probably damaging Het
Nrd1 A T 4: 109,038,045 R241* probably null Het
Ofcc1 G A 13: 40,280,429 H67Y probably damaging Het
Olfr1331 A G 4: 118,869,182 T134A possibly damaging Het
Olfr467 A G 7: 107,814,637 T18A probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Pard3b G T 1: 62,010,466 A128S probably benign Het
Plat T C 8: 22,773,648 Y188H probably benign Het
Pop1 A G 15: 34,530,179 K908E possibly damaging Het
Pten A G 19: 32,758,466 I8V probably benign Het
Pwwp2a C T 11: 43,706,141 A436V probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sdk1 T C 5: 142,188,145 C2023R possibly damaging Het
Serpina1d A C 12: 103,763,842 D360E possibly damaging Het
Smgc G A 15: 91,841,905 S18N possibly damaging Het
Snx27 A T 3: 94,502,850 probably null Het
Spem1 T G 11: 69,821,437 K134Q probably damaging Het
Srgap3 T A 6: 112,775,561 M321L probably benign Het
Tanc1 T C 2: 59,772,353 C163R possibly damaging Het
Ube2ql1 A T 13: 69,739,327 L5H unknown Het
Ubn2 T C 6: 38,461,527 I225T probably damaging Het
Vmn1r181 A C 7: 23,984,316 T69P probably damaging Het
Vmn2r110 A G 17: 20,596,232 F10L probably benign Het
Yeats2 T C 16: 20,162,029 M236T probably damaging Het
Other mutations in Serpinb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Serpinb9b APN 13 33035625 missense probably benign 0.00
IGL00518:Serpinb9b APN 13 33039570 missense probably benign 0.17
IGL01939:Serpinb9b APN 13 33039665 missense probably damaging 0.99
IGL02472:Serpinb9b APN 13 33039970 utr 3 prime probably benign
IGL02632:Serpinb9b APN 13 33039823 missense probably benign 0.01
R0255:Serpinb9b UTSW 13 33038020 missense probably benign
R0667:Serpinb9b UTSW 13 33032926 nonsense probably null
R0699:Serpinb9b UTSW 13 33033566 missense probably benign 0.00
R0703:Serpinb9b UTSW 13 33032981 missense probably benign 0.29
R1605:Serpinb9b UTSW 13 33038129 critical splice donor site probably null
R1623:Serpinb9b UTSW 13 33029565 missense possibly damaging 0.61
R1815:Serpinb9b UTSW 13 33039904 missense probably damaging 1.00
R1920:Serpinb9b UTSW 13 33039548 critical splice acceptor site probably null
R1987:Serpinb9b UTSW 13 33029559 missense probably benign 0.07
R1988:Serpinb9b UTSW 13 33029559 missense probably benign 0.07
R3035:Serpinb9b UTSW 13 33029546 missense possibly damaging 0.81
R3683:Serpinb9b UTSW 13 33029598 missense probably damaging 0.98
R3758:Serpinb9b UTSW 13 33035588 missense probably damaging 1.00
R4677:Serpinb9b UTSW 13 33039823 missense probably damaging 0.97
R5412:Serpinb9b UTSW 13 33029513 missense probably benign 0.00
R5481:Serpinb9b UTSW 13 33038093 missense possibly damaging 0.93
R5957:Serpinb9b UTSW 13 33039848 missense possibly damaging 0.81
R6797:Serpinb9b UTSW 13 33029484 missense possibly damaging 0.60
X0019:Serpinb9b UTSW 13 33035531 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATGCGAATACTCATTGCC -3'
(R):5'- ACAGAACCATGATGGGCCAC -3'

Sequencing Primer
(F):5'- CATTGCCCTTGTATGACAATGTAGG -3'
(R):5'- GAGGAATGATGCCCTCAGC -3'
Posted On2016-11-09