Incidental Mutation 'R5672:Abcf3'
ID442694
Institutional Source Beutler Lab
Gene Symbol Abcf3
Ensembl Gene ENSMUSG00000003234
Gene NameATP-binding cassette, sub-family F (GCN20), member 3
Synonyms
MMRRC Submission 043174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5672 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20548577-20561379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20549252 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 74 (Q74L)
Ref Sequence ENSEMBL: ENSMUSP00000156048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003319] [ENSMUST00000007216] [ENSMUST00000232490] [ENSMUST00000232680]
Predicted Effect probably benign
Transcript: ENSMUST00000003319
AA Change: Q80L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003319
Gene: ENSMUSG00000003234
AA Change: Q80L

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
AAA 202 401 3.23e-11 SMART
low complexity region 423 435 N/A INTRINSIC
low complexity region 457 469 N/A INTRINSIC
AAA 517 684 4.68e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007216
SMART Domains Protein: ENSMUSP00000007216
Gene: ENSMUSG00000022841

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 6.7e-8 PFAM
Pfam:Adap_comp_sub 159 435 3.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154660
Predicted Effect probably benign
Transcript: ENSMUST00000231258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232127
Predicted Effect probably benign
Transcript: ENSMUST00000232490
AA Change: Q79L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232680
AA Change: Q74L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,763,927 T67A probably benign Het
A4gnt A G 9: 99,620,330 N181S possibly damaging Het
Ankrd13c T C 3: 157,961,027 probably null Het
Bub1 A G 2: 127,804,880 F827L possibly damaging Het
Cyp2c55 A G 19: 39,035,546 I355V probably benign Het
Dido1 A G 2: 180,671,903 S319P probably damaging Het
Efna5 A T 17: 62,881,030 V34D probably damaging Het
Fam131a G T 16: 20,699,639 E88D probably damaging Het
Fsip2 A T 2: 82,987,494 R4524* probably null Het
Gm6899 C T 11: 26,593,484 probably benign Het
Iqcg C T 16: 33,019,508 R356Q probably damaging Het
Itgae T A 11: 73,145,551 I1105N possibly damaging Het
Klb T C 5: 65,379,949 I874T possibly damaging Het
Klc3 T C 7: 19,396,331 Y307C probably damaging Het
Lrp1b T A 2: 41,341,759 H378L probably benign Het
Mxd4 G A 5: 34,177,700 R114C probably damaging Het
Nrd1 A T 4: 109,038,045 R241* probably null Het
Ofcc1 G A 13: 40,280,429 H67Y probably damaging Het
Olfr1331 A G 4: 118,869,182 T134A possibly damaging Het
Olfr467 A G 7: 107,814,637 T18A probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Pard3b G T 1: 62,010,466 A128S probably benign Het
Plat T C 8: 22,773,648 Y188H probably benign Het
Pop1 A G 15: 34,530,179 K908E possibly damaging Het
Pten A G 19: 32,758,466 I8V probably benign Het
Pwwp2a C T 11: 43,706,141 A436V probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sdk1 T C 5: 142,188,145 C2023R possibly damaging Het
Serpina1d A C 12: 103,763,842 D360E possibly damaging Het
Serpinb9b A G 13: 33,039,599 D258G probably benign Het
Smgc G A 15: 91,841,905 S18N possibly damaging Het
Snx27 A T 3: 94,502,850 probably null Het
Spem1 T G 11: 69,821,437 K134Q probably damaging Het
Srgap3 T A 6: 112,775,561 M321L probably benign Het
Tanc1 T C 2: 59,772,353 C163R possibly damaging Het
Ube2ql1 A T 13: 69,739,327 L5H unknown Het
Ubn2 T C 6: 38,461,527 I225T probably damaging Het
Vmn1r181 A C 7: 23,984,316 T69P probably damaging Het
Vmn2r110 A G 17: 20,596,232 F10L probably benign Het
Yeats2 T C 16: 20,162,029 M236T probably damaging Het
Other mutations in Abcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Abcf3 APN 16 20551684 missense probably damaging 0.98
IGL01570:Abcf3 APN 16 20559998 missense probably damaging 1.00
IGL02239:Abcf3 APN 16 20550636 missense possibly damaging 0.85
R0158:Abcf3 UTSW 16 20552566 missense probably damaging 1.00
R0270:Abcf3 UTSW 16 20560168 splice site probably null
R0579:Abcf3 UTSW 16 20550648 missense probably benign
R0671:Abcf3 UTSW 16 20550487 missense probably damaging 1.00
R0799:Abcf3 UTSW 16 20559334 missense probably damaging 1.00
R1384:Abcf3 UTSW 16 20559303 missense probably damaging 1.00
R1393:Abcf3 UTSW 16 20560430 missense probably benign 0.01
R2356:Abcf3 UTSW 16 20560499 missense probably benign 0.01
R2910:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R2911:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R3081:Abcf3 UTSW 16 20559364 missense probably benign 0.09
R3852:Abcf3 UTSW 16 20560439 missense probably damaging 1.00
R4707:Abcf3 UTSW 16 20549058 missense possibly damaging 0.91
R4752:Abcf3 UTSW 16 20550576 missense probably damaging 1.00
R4885:Abcf3 UTSW 16 20551675 missense probably benign 0.05
R5817:Abcf3 UTSW 16 20549083 missense possibly damaging 0.95
R6013:Abcf3 UTSW 16 20550561 unclassified probably null
R6019:Abcf3 UTSW 16 20552451 missense possibly damaging 0.60
R6026:Abcf3 UTSW 16 20550570 missense probably damaging 1.00
R6952:Abcf3 UTSW 16 20549734 splice site probably null
X0066:Abcf3 UTSW 16 20559697 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAACTATTGCAAGAAGTGTCCG -3'
(R):5'- TACCGCTAGCTCCTACAAGC -3'

Sequencing Primer
(F):5'- ATGACGCTGGCATTAGGGC -3'
(R):5'- CCTACAAGCCTTGTTGTTGAG -3'
Posted On2016-11-09