Incidental Mutation 'R5673:Mybbp1a'
ID442733
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene NameMYB binding protein (P160) 1a
Synonymsp160MBP, p67MBP
MMRRC Submission 043175-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72441355-72451768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72444925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 421 (V421I)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633]
Predicted Effect probably benign
Transcript: ENSMUST00000045633
AA Change: V421I

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: V421I

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Abhd18 T A 3: 40,923,451 M94K probably damaging Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Aqp5 G A 15: 99,594,165 V98I probably benign Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gm14226 T A 2: 155,024,922 S266R possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mrgprb2 A T 7: 48,552,373 F201L probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r65 G T 7: 84,947,407 L147I probably benign Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72443567 missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72445666 missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72443918 splice site probably benign
IGL03344:Mybbp1a APN 11 72445202 missense probably damaging 1.00
R0276:Mybbp1a UTSW 11 72450107 unclassified probably null
R0437:Mybbp1a UTSW 11 72448848 missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72448376 missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72443648 missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72445217 missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72441445 missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72446195 missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72448737 missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72447170 missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72451287 missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72445712 missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72447971 missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72445640 missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72445214 missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72448113 missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72450636 missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72446172 missense probably damaging 1.00
R5947:Mybbp1a UTSW 11 72442431 missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72446012 missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72447566 missense probably benign 0.00
X0050:Mybbp1a UTSW 11 72441677 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCAGAGATAAGTACATACGTGG -3'
(R):5'- CCGACCTCTTGTCAGGAGAAAC -3'

Sequencing Primer
(F):5'- TACCTTCCTAGAGGGGTGC -3'
(R):5'- CTTGTCAGGAGAAACAAGGGCAC -3'
Posted On2016-11-09