Incidental Mutation 'R5677:Abca8a'
ID442831
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 043316-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5677 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110038399 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1296 (V1296D)
Ref Sequence ENSEMBL: ENSMUSP00000102275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046223
AA Change: V1295D

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: V1295D

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100287
AA Change: V1296D

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: V1296D

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106664
AA Change: V1296D

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: V1296D

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apbb1 A C 7: 105,559,246 D617E probably damaging Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Col12a1 T C 9: 79,699,321 R607G probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Piezo2 A T 18: 63,117,696 L212Q possibly damaging Het
Piezo2 G C 18: 63,117,697 L444V probably benign Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Svil T A 18: 5,046,823 L110* probably null Het
Syncrip T C 9: 88,456,709 probably benign Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Trps1 T C 15: 50,846,108 D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAACAGCCACTCTACTGTG -3'
(R):5'- GCTAGCGAGGTGTGAAATTG -3'

Sequencing Primer
(F):5'- GCCACTCTACTGTGAAACGAAG -3'
(R):5'- CCCGTGTTAGTGCAAAGAAAGTTCTG -3'
Posted On2016-11-09