Incidental Mutation 'R5677:Trps1'
ID442851
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission 043316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5677 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50846108 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 282 (D282G)
Ref Sequence ENSEMBL: ENSMUSP00000139017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: D278G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: D278G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: D278G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: D278G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: D282G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: D282G

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183997
AA Change: D282G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: D282G

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184885
AA Change: D232G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: D232G

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185183
SMART Domains Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8a A T 11: 110,038,399 V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apbb1 A C 7: 105,559,246 D617E probably damaging Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Col12a1 T C 9: 79,699,321 R607G probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Piezo2 A T 18: 63,117,696 L212Q possibly damaging Het
Piezo2 G C 18: 63,117,697 L444V probably benign Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Svil T A 18: 5,046,823 L110* probably null Het
Syncrip T C 9: 88,456,709 probably benign Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTAAAAGCTATGTGTCTGG -3'
(R):5'- TCTGTCTCCAGAGCTTCAGGAC -3'

Sequencing Primer
(F):5'- CTTGGGAGCTGACACTGAAC -3'
(R):5'- CTCCAGAGCTTCAGGACTTTAAATGC -3'
Posted On2016-11-09