Incidental Mutation 'R5677:Piezo2'
ID442861
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 043316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5677 (G1)
Quality Score210
Status Not validated
Chromosome18
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63117696 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 212 (L212Q)
Ref Sequence ENSEMBL: ENSMUSP00000138170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
Predicted Effect probably benign
Transcript: ENSMUST00000046860
AA Change: L444Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: L444Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: L444Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: L444Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182166
AA Change: L336Q
Predicted Effect possibly damaging
Transcript: ENSMUST00000182233
AA Change: L212Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: L212Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183217
AA Change: L444Q

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: L444Q

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik C T 10: 28,986,229 V22I probably benign Het
4930430A15Rik T C 2: 111,211,565 T342A probably benign Het
4931423N10Rik T A 2: 23,212,718 L156Q probably damaging Het
Abca8a A T 11: 110,038,399 V1296D possibly damaging Het
Abca8b C T 11: 109,940,861 S1328N probably damaging Het
Adcy1 G A 11: 7,161,914 M926I probably damaging Het
Aff4 G T 11: 53,400,275 M687I possibly damaging Het
Agbl2 T A 2: 90,807,978 Y636N possibly damaging Het
Agtr1a A T 13: 30,381,584 I211F probably damaging Het
Alkbh8 T G 9: 3,385,147 S480A possibly damaging Het
Ankrd13b A T 11: 77,477,544 V84E probably damaging Het
Ap3b1 C T 13: 94,528,196 T881I unknown Het
Apbb1 A C 7: 105,559,246 D617E probably damaging Het
Apobec4 A G 1: 152,757,282 R354G probably benign Het
BC003331 G A 1: 150,374,837 L319F probably damaging Het
Brdt T G 5: 107,348,617 C198W possibly damaging Het
Cacna1b G T 2: 24,679,358 H851Q possibly damaging Het
Car2 G T 3: 14,898,055 V217F possibly damaging Het
Ccdc24 A C 4: 117,869,880 probably benign Het
Chodl C A 16: 78,941,315 A57E probably damaging Het
Clgn G T 8: 83,409,538 C185F probably damaging Het
Cltc G T 11: 86,705,242 N1223K probably damaging Het
Cnot10 T C 9: 114,629,093 N115S probably damaging Het
Col12a1 T C 9: 79,699,321 R607G probably damaging Het
Cpd A G 11: 76,799,825 V835A probably benign Het
Csmd3 G C 15: 48,622,051 L153V probably damaging Het
Ctr9 A G 7: 111,044,002 H527R probably benign Het
Cwc22 G A 2: 77,929,443 R87W probably damaging Het
D930020B18Rik T A 10: 121,669,201 N107K probably benign Het
Dgkg C A 16: 22,570,171 V418L probably benign Het
Dhx40 A G 11: 86,800,963 probably null Het
Diaph1 A T 18: 37,855,951 M910K probably damaging Het
Diras2 T A 13: 52,507,675 M199L possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock5 T A 14: 67,777,603 Q1302H probably benign Het
Dync1i2 T C 2: 71,228,623 S90P probably benign Het
E2f8 A T 7: 48,867,195 V812E probably damaging Het
Egfem1 C A 3: 29,690,174 Q521K probably damaging Het
Fbxl18 A T 5: 142,878,720 C699* probably null Het
Fgf3 C T 7: 144,838,783 R26* probably null Het
Fpr-rs7 T G 17: 20,114,103 I42L probably benign Het
Gm13101 A T 4: 143,965,138 D338E possibly damaging Het
Gm3159 T A 14: 4,398,582 M91K probably damaging Het
Gprin3 A G 6: 59,353,892 S477P possibly damaging Het
Grm8 A T 6: 27,761,204 probably null Het
Hepacam2 A T 6: 3,466,142 D420E probably damaging Het
Hmcn1 A T 1: 150,609,778 W4358R probably benign Het
Ifna6 G A 4: 88,827,719 A102T probably benign Het
Ighv2-2 T C 12: 113,588,522 Q32R probably benign Het
Igkv1-131 T A 6: 67,766,258 Q47L possibly damaging Het
Il16 T C 7: 83,674,553 E263G probably damaging Het
Kansl1 A T 11: 104,335,148 C981S probably benign Het
Lrp1 A T 10: 127,574,429 F1483I probably damaging Het
Ltf T C 9: 111,020,912 M1T probably null Het
Ly75 C T 2: 60,299,082 R1653H probably benign Het
Macrod2 T C 2: 142,176,667 F240S probably damaging Het
Man1c1 T C 4: 134,569,060 E433G probably damaging Het
Mansc4 A T 6: 147,081,549 M130K probably benign Het
Mccc1 C T 3: 35,990,048 probably null Het
Mink1 G T 11: 70,605,165 R75L possibly damaging Het
Mst1 A G 9: 108,081,286 D65G probably damaging Het
Myo9b C T 8: 71,343,686 A857V probably damaging Het
Ndufa4 A G 6: 11,900,575 V70A probably benign Het
Npat T A 9: 53,555,100 S230T probably benign Het
Nr1d1 A G 11: 98,771,308 Y167H probably damaging Het
Oca2 A G 7: 56,414,462 D735G probably damaging Het
Olfr13 T C 6: 43,174,331 V115A probably benign Het
Olfr1359 C T 13: 21,703,223 T74I probably benign Het
Olfr1383 A G 11: 49,523,944 T74A probably damaging Het
Olfr835 T A 9: 19,035,558 I145N possibly damaging Het
Otop1 A G 5: 38,300,163 Y422C probably damaging Het
Pde4dip G A 3: 97,841,648 R126* probably null Het
Pdp2 C T 8: 104,594,688 P390S probably damaging Het
Pds5b A T 5: 150,716,461 T14S possibly damaging Het
Pfkp T C 13: 6,588,595 E580G probably damaging Het
Pla2g4d T A 2: 120,278,948 T207S possibly damaging Het
Plk2 C A 13: 110,399,057 T471K possibly damaging Het
Ppp1r3g G A 13: 35,969,262 E222K probably damaging Het
Prkcg A G 7: 3,323,458 D480G probably damaging Het
Pxdc1 T A 13: 34,652,195 T81S probably benign Het
Rnf150 A T 8: 83,003,599 K253* probably null Het
Rsg1 C T 4: 141,219,866 P186L probably benign Het
Sae1 T C 7: 16,370,462 probably null Het
Scin C T 12: 40,063,259 D538N probably damaging Het
Serpinb3c C A 1: 107,271,803 K329N probably damaging Het
Sgo2b T A 8: 63,926,974 K941N possibly damaging Het
Six1 C T 12: 73,046,284 S48N possibly damaging Het
Slc39a8 G A 3: 135,884,688 G381R probably damaging Het
Slc9b1 A G 3: 135,357,559 K35E unknown Het
Srek1 C T 13: 103,759,244 A274T probably damaging Het
Steap2 A T 5: 5,677,497 Y279* probably null Het
Svil T A 18: 5,046,823 L110* probably null Het
Syncrip T C 9: 88,456,709 probably benign Het
Tcf20 A G 15: 82,853,242 I1336T probably benign Het
Tecpr1 T A 5: 144,218,633 K36* probably null Het
Tenm2 A G 11: 36,141,683 V670A probably damaging Het
Thbd G A 2: 148,407,366 T194I probably damaging Het
Tm9sf2 A T 14: 122,151,962 probably null Het
Tmtc4 A T 14: 122,950,499 I225N probably damaging Het
Tpp1 C T 7: 105,747,536 V425M probably damaging Het
Trbc2 T A 6: 41,547,812 Y144* probably null Het
Trps1 T C 15: 50,846,108 D282G probably damaging Het
Tsc22d4 T A 5: 137,747,142 S9R probably damaging Het
Upp1 T A 11: 9,136,025 D287E probably benign Het
Uso1 A C 5: 92,201,299 Q916H probably damaging Het
Uty T A Y: 1,134,902 Y884F probably damaging Het
Vmn1r222 T C 13: 23,232,780 R88G probably damaging Het
Vmn1r79 T C 7: 12,177,001 V270A possibly damaging Het
Zbtb22 T C 17: 33,917,735 S285P probably benign Het
Zfp385a A G 15: 103,318,065 V82A probably damaging Het
Zfp59 T C 7: 27,854,169 F349L probably benign Het
Zfp780b T G 7: 27,962,799 H777P probably benign Het
Zfp82 T C 7: 30,057,124 T178A probably benign Het
Zfp850 T C 7: 27,989,088 Y565C probably damaging Het
Zfp957 A G 14: 79,212,767 Y531H probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTCACTTCACTGTAGGGC -3'
(R):5'- AATGGTTCAGCCTCTAATCAGC -3'

Sequencing Primer
(F):5'- GACGTCAGTATTCTGCTAGCAGC -3'
(R):5'- AATCAGCTTTTTATCCTGCATGATGC -3'
Posted On2016-11-09