Incidental Mutation 'R5678:Dhrs7'
ID442902
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Namedehydrogenase/reductase (SDR family) member 7
SynonymsretSDR4, 2310016E22Rik, 5730564L20Rik, retDSR4
MMRRC Submission 043317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72650353-72664909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72657332 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 130 (G130D)
Ref Sequence ENSEMBL: ENSMUSP00000021512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000220821]
Predicted Effect probably damaging
Transcript: ENSMUST00000021512
AA Change: G130D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: G130D

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220821
Predicted Effect unknown
Transcript: ENSMUST00000221750
AA Change: G153D
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72659350 missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72652390 missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72664692 missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72653086 splice site probably benign
R0691:Dhrs7 UTSW 12 72652351 missense probably damaging 1.00
R1640:Dhrs7 UTSW 12 72652315 missense possibly damaging 0.86
R1696:Dhrs7 UTSW 12 72653120 missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72659464 missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72653165 missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72652266 missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72653177 missense probably damaging 1.00
R2205:Dhrs7 UTSW 12 72656370 missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72652381 missense probably benign 0.00
R3431:Dhrs7 UTSW 12 72664727 missense probably damaging 0.99
R4492:Dhrs7 UTSW 12 72653125 missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72652251 missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72653118 missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72657410 missense probably damaging 1.00
R5076:Dhrs7 UTSW 12 72659481 missense probably benign 0.00
R6361:Dhrs7 UTSW 12 72664659 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCAGATATTAACTTCACCCTTG -3'
(R):5'- TGCTTAGGTAGTGCCTCCTG -3'

Sequencing Primer
(F):5'- CACCCTTGCTTCTTGGGG -3'
(R):5'- TCCTGGAGTGGGTTCACC -3'
Posted On2016-11-09