Incidental Mutation 'R5678:Prune2'
ID442915
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission 043317-MU
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17118668 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 512 (D512G)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect probably damaging
Transcript: ENSMUST00000087689
AA Change: D512G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: D512G

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atr C T 9: 95,951,487 Q2597* probably null Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense not run
R7102:Prune2 UTSW 19 17121213 missense not run
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCCTCAGTGACGACAG -3'
(R):5'- CAGAGTTATCCCCTGAGCTTTC -3'

Sequencing Primer
(F):5'- AGTGACGACAGCCCCGTG -3'
(R):5'- AGCTTTCTTGTCGCTGGATAAAC -3'
Posted On2016-11-09