Incidental Mutation 'R5680:G3bp2'
ID442972
Institutional Source Beutler Lab
Gene Symbol G3bp2
Ensembl Gene ENSMUSG00000029405
Gene NameGTPase activating protein (SH3 domain) binding protein 2
SynonymsG3BP, E430034L04Rik, G3BP2
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92052146-92083719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92068360 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 106 (R106G)
Ref Sequence ENSEMBL: ENSMUSP00000144456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113127] [ENSMUST00000164378] [ENSMUST00000167918] [ENSMUST00000169094] [ENSMUST00000201820] [ENSMUST00000202123] [ENSMUST00000202258]
Predicted Effect probably damaging
Transcript: ENSMUST00000113127
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108752
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164378
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128353
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167918
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132469
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169094
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128244
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 133 1.1e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201820
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144404
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 117 9.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201824
Predicted Effect probably damaging
Transcript: ENSMUST00000202123
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143804
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202125
Predicted Effect probably damaging
Transcript: ENSMUST00000202258
AA Change: R106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144456
Gene: ENSMUSG00000029405
AA Change: R106G

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202352
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in G3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:G3bp2 APN 5 92065848 missense probably damaging 0.98
IGL02124:G3bp2 APN 5 92073247 missense possibly damaging 0.92
IGL02519:G3bp2 APN 5 92066524 missense possibly damaging 0.90
IGL03146:G3bp2 APN 5 92066540 missense probably damaging 1.00
IGL03183:G3bp2 APN 5 92055046 missense possibly damaging 0.82
IGL03195:G3bp2 APN 5 92068508 splice site probably benign
IGL03385:G3bp2 APN 5 92068395 missense probably damaging 1.00
R0558:G3bp2 UTSW 5 92073197 missense probably damaging 1.00
R1067:G3bp2 UTSW 5 92063328 splice site probably benign
R1621:G3bp2 UTSW 5 92056278 missense probably damaging 1.00
R2294:G3bp2 UTSW 5 92058028 missense probably damaging 1.00
R3698:G3bp2 UTSW 5 92056280 missense possibly damaging 0.91
R4159:G3bp2 UTSW 5 92064401 missense probably benign 0.00
R4195:G3bp2 UTSW 5 92055416 missense probably damaging 0.99
R4754:G3bp2 UTSW 5 92054909 missense possibly damaging 0.85
R5518:G3bp2 UTSW 5 92068488 missense probably benign 0.00
R5937:G3bp2 UTSW 5 92055397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCAGAGATACCAGGTATGC -3'
(R):5'- TGGGTAGTTAATGTGGTAGCACAAG -3'

Sequencing Primer
(F):5'- TCAGAGATACCAGGTATGCAAATAG -3'
(R):5'- GCACAAGAAGTTTATTTTCTTCACCC -3'
Posted On2016-11-09