Incidental Mutation 'R5680:Psca'
ID442996
Institutional Source Beutler Lab
Gene Symbol Psca
Ensembl Gene ENSMUSG00000022598
Gene Nameprostate stem cell antigen
Synonyms2210408B04Rik
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74714839-74717069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74716099 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000023265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023265]
Predicted Effect probably benign
Transcript: ENSMUST00000023265
AA Change: D44G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023265
Gene: ENSMUSG00000022598
AA Change: D44G

DomainStartEndE-ValueType
LU 21 107 7.4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188070
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are viable and fertile and show no significant differences in spontaneous or radiation-induced primary epithelial tumor formation relative to wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Psca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03391:Psca APN 15 74714868 missense probably benign 0.01
R5257:Psca UTSW 15 74716391 missense probably damaging 0.97
R5258:Psca UTSW 15 74716391 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCTCCACTCTGTGTTGGAGATG -3'
(R):5'- TAAAGCCAGGTCCTGATAGCC -3'

Sequencing Primer
(F):5'- CCACTCTGTGTTGGAGATGGGAAG -3'
(R):5'- TCCGGAACATGCTAAACTTCTGG -3'
Posted On2016-11-09