Incidental Mutation 'R5680:Togaram2'
ID442999
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene NameTOG array regulator of axonemal microtubules 2
SynonymsFam179a, 4632412N22Rik
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71673261-71729669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71689209 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 68 (R68K)
Ref Sequence ENSEMBL: ENSMUSP00000122691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
Predicted Effect probably benign
Transcript: ENSMUST00000097284
AA Change: R68K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761
AA Change: R68K

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122869
Predicted Effect probably benign
Transcript: ENSMUST00000144479
AA Change: R69K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761
AA Change: R69K

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153445
AA Change: R68K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761
AA Change: R68K

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156665
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Pik3c3 T A 18: 30,277,113 Y133* probably null Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 71725004 missense probably damaging 1.00
IGL01298:Togaram2 APN 17 71716513 missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 71714698 missense probably benign 0.06
IGL01691:Togaram2 APN 17 71729490 missense probably null 0.02
IGL02165:Togaram2 APN 17 71697866 missense probably benign 0.00
IGL02186:Togaram2 APN 17 71685171 missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 71729239 missense probably damaging 0.97
IGL02712:Togaram2 APN 17 71704754 missense probably benign 0.04
IGL03000:Togaram2 APN 17 71717370 missense probably benign 0.08
IGL03209:Togaram2 APN 17 71695745 critical splice donor site probably null
R0211:Togaram2 UTSW 17 71729248 missense probably damaging 1.00
R0212:Togaram2 UTSW 17 71724983 missense probably damaging 1.00
R0219:Togaram2 UTSW 17 71714230 splice site probably benign
R0268:Togaram2 UTSW 17 71697998 critical splice donor site probably null
R0617:Togaram2 UTSW 17 71700509 missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 71716444 missense probably damaging 1.00
R0972:Togaram2 UTSW 17 71707314 missense probably damaging 1.00
R1635:Togaram2 UTSW 17 71697851 missense probably benign 0.05
R1799:Togaram2 UTSW 17 71691455 missense probably damaging 1.00
R2062:Togaram2 UTSW 17 71716365 missense probably benign 0.26
R2414:Togaram2 UTSW 17 71716309 intron probably benign
R2866:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R4066:Togaram2 UTSW 17 71716238 intron probably benign
R4807:Togaram2 UTSW 17 71697923 missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71687672 missense probably damaging 0.96
R5975:Togaram2 UTSW 17 71729205 missense probably damaging 1.00
R5996:Togaram2 UTSW 17 71704783 missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71689271 missense probably damaging 0.99
R6682:Togaram2 UTSW 17 71704754 missense probably benign 0.04
R6922:Togaram2 UTSW 17 71707134 missense probably damaging 1.00
R6956:Togaram2 UTSW 17 71729188 missense probably benign 0.00
R6968:Togaram2 UTSW 17 71709613 missense probably damaging 1.00
R7007:Togaram2 UTSW 17 71709643 missense probably damaging 0.99
R7015:Togaram2 UTSW 17 71709568 missense possibly damaging 0.62
R7140:Togaram2 UTSW 17 71714766 missense probably benign 0.00
X0063:Togaram2 UTSW 17 71707197 missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 71714280 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAAGTTCACCCAGCCCTTC -3'
(R):5'- CTTGAGAAGATGCCGCCATG -3'

Sequencing Primer
(F):5'- CTTCACAACAACAGCTGAACATTTTG -3'
(R):5'- ATGCCTTCTGAGAGCCGTC -3'
Posted On2016-11-09