Incidental Mutation 'R5681:Dnhd1'
ID443039
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Namedynein heavy chain domain 1
Synonyms8030491N06Rik
Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2:  ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5681 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105650827-105721799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105703209 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2523 (R2523Q)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
Predicted Effect probably damaging
Transcript: ENSMUST00000145988
AA Change: R2523Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: R2523Q

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,459,308 probably null Het
Acoxl T C 2: 127,972,639 F45S possibly damaging Het
Adora2b T A 11: 62,249,241 V47E probably damaging Het
Amdhd2 A G 17: 24,156,040 I396T probably damaging Het
Arhgap5 G A 12: 52,519,779 D1178N probably benign Het
Atp10d T C 5: 72,246,946 probably benign Het
Baiap3 A G 17: 25,249,373 S264P probably damaging Het
BC055324 T C 1: 163,962,085 N627S probably damaging Het
Brinp3 A T 1: 146,901,746 I644F probably benign Het
Ccdc66 T C 14: 27,486,741 R675G probably benign Het
Cnr2 T G 4: 135,916,689 M26R probably damaging Het
Col6a2 A T 10: 76,609,251 probably null Het
Cux1 A G 5: 136,308,184 W696R probably damaging Het
D6Ertd527e A G 6: 87,111,206 N117S unknown Het
Dnah12 T C 14: 26,815,495 C2234R probably benign Het
Dock2 T G 11: 34,249,836 I1405L probably benign Het
Dsg1c T C 18: 20,283,213 F724L probably damaging Het
Enoph1 T C 5: 100,062,277 probably null Het
Epha10 A T 4: 124,902,566 Q356L unknown Het
Fbln2 G T 6: 91,271,796 V1148L probably damaging Het
Gm11397 G A 13: 33,395,829 C20Y probably damaging Het
Gm8251 A T 1: 44,061,464 V158D possibly damaging Het
Gp2 C T 7: 119,452,294 V233M possibly damaging Het
Gtf2ird1 T A 5: 134,363,318 S800C probably damaging Het
Hat1 A G 2: 71,434,209 probably null Het
Hpdl A T 4: 116,820,842 S141T probably benign Het
Klhl29 A G 12: 5,090,669 S658P possibly damaging Het
Lifr T A 15: 7,191,084 I1065N probably damaging Het
Lrrn2 G T 1: 132,937,161 probably benign Het
March9 T A 10: 127,058,303 I144F probably benign Het
Mtnr1a A G 8: 45,087,937 I312V possibly damaging Het
Ngf T A 3: 102,520,353 F139L probably damaging Het
Nipbl T C 15: 8,301,382 I2318V probably benign Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nphs1 A G 7: 30,486,625 D1227G probably benign Het
Olfm3 C A 3: 115,122,275 N285K probably benign Het
Olfr1313 T A 2: 112,072,377 I69F probably benign Het
Olfr3 C A 2: 36,812,681 S137I probably benign Het
Olfr855 G A 9: 19,584,899 D121N probably damaging Het
Olfr870 A G 9: 20,170,795 Y259H probably damaging Het
Olfr887 C T 9: 38,085,631 S265F possibly damaging Het
Osbp2 A G 11: 3,863,486 S128P probably benign Het
Otop2 A T 11: 115,326,859 M174L probably damaging Het
Pard3 A G 8: 127,389,433 T668A possibly damaging Het
Pkhd1 T C 1: 20,547,461 T967A possibly damaging Het
Pls1 A G 9: 95,787,012 V52A probably damaging Het
Ptcd3 T C 6: 71,907,659 K64R probably damaging Het
Pxn T C 5: 115,544,534 W69R possibly damaging Het
Rai14 T C 15: 10,575,120 D584G probably damaging Het
Safb G A 17: 56,599,000 probably benign Het
Serinc2 A C 4: 130,265,076 L10R probably damaging Het
Serpinb12 A T 1: 106,946,701 H52L probably benign Het
Serpinf2 A G 11: 75,435,939 Y273H probably damaging Het
Slc2a10 T A 2: 165,514,740 S107T probably benign Het
Slc41a3 T C 6: 90,640,946 L318P probably damaging Het
Slc6a3 A T 13: 73,538,735 I74F probably damaging Het
Snrnp200 G A 2: 127,225,135 G788D probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sox11 G T 12: 27,341,824 D195E probably benign Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Tab2 A G 10: 7,920,073 I215T probably damaging Het
Ttn C T 2: 76,830,598 V7422I possibly damaging Het
Unc13c A T 9: 73,546,075 probably null Het
Wdr17 T C 8: 54,662,869 D633G probably damaging Het
Wdsub1 A T 2: 59,852,895 M445K probably damaging Het
Xpc A G 6: 91,504,120 F257L probably damaging Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105677995 missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105657211 missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105692675 missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105721688 missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105713909 missense probably benign
IGL01714:Dnhd1 APN 7 105720942 missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105713754 missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105652030 missense probably benign
IGL01999:Dnhd1 APN 7 105721215 missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105678309 missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105720802 missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105721744 missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105721481 missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105720741 missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105719882 missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105714475 missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105713733 missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105655723 missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105668514 missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105720924 missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105720114 missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105694395 missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105714045 missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105651624 missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105695751 missense probably benign
R0669:Dnhd1 UTSW 7 105693704 missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105651906 missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105709171 missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105713031 missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105696899 missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105694153 missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105720124 missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105721273 critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105668463 missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105693660 missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105704148 missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105703206 missense probably benign 0.00
R1615:Dnhd1 UTSW 7 105713706 missense possibly damaging 0.74
R1656:Dnhd1 UTSW 7 105714281 missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105693828 missense probably benign
R1723:Dnhd1 UTSW 7 105714920 missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105693972 missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105655767 missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105704205 missense probably benign
R1920:Dnhd1 UTSW 7 105713407 missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105652252 missense probably damaging 1.00
R1925:Dnhd1 UTSW 7 105673854 missense probably damaging 0.96
R1934:Dnhd1 UTSW 7 105708582 missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105704921 missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105677971 missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105693721 missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105703772 missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105705399 missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105674421 missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105710090 missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105703467 missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105693664 missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105720231 missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105712559 missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105720229 missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105696565 critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105694761 nonsense probably null
R3405:Dnhd1 UTSW 7 105694761 nonsense probably null
R3439:Dnhd1 UTSW 7 105694785 missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105713122 missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105714838 missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105709588 missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105712998 missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105696728 nonsense probably null
R4565:Dnhd1 UTSW 7 105651956 missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105657166 splice site probably null
R4584:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105714030 missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105715446 missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105703644 missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105655741 missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105721117 missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105714281 missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105703964 missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105714808 missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105656957 missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105713633 missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105713076 missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105693697 missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105713440 missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105714552 missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105696460 missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105703923 missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105685761 missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105674037 missense probably benign
R5258:Dnhd1 UTSW 7 105674037 missense probably benign
R5273:Dnhd1 UTSW 7 105714482 missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105714437 missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105713684 missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105710123 missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105714156 missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105714821 missense probably damaging 0.99
R5682:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105674188 missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105705010 missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105655774 missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105719895 missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105720181 missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105695748 missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105720504 missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105713987 missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105709440 missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105704048 missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105652009 missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105693370 missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105694066 missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105694610 missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105677886 missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105703799 missense probably benign
R6663:Dnhd1 UTSW 7 105685692 intron probably null
R6730:Dnhd1 UTSW 7 105703875 missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105720637 missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105703373 missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105719930 missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105703728 missense probably benign
R6860:Dnhd1 UTSW 7 105678266 missense probably benign
R6898:Dnhd1 UTSW 7 105687377 missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105715563 missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105713688 missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105704585 missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105714210 missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105720798 missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105694954 missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105715261 missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105708532 missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105713985 missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105693766 missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105710027 missense probably benign 0.03
Z1088:Dnhd1 UTSW 7 105712727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCCAGAGAAGAACTGCCAGC -3'
(R):5'- CTGCAGGCTTCCCAAAATGTG -3'

Sequencing Primer
(F):5'- CAGTCAACTTCCTTGCCA -3'
(R):5'- TGAAGGCATGAAACACTTGCAC -3'
Posted On2016-11-09