Incidental Mutation 'R5681:Dsg1c'
ID443073
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5681 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20283213 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 724 (F724L)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: F724L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: F724L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,459,308 probably null Het
Acoxl T C 2: 127,972,639 F45S possibly damaging Het
Adora2b T A 11: 62,249,241 V47E probably damaging Het
Amdhd2 A G 17: 24,156,040 I396T probably damaging Het
Arhgap5 G A 12: 52,519,779 D1178N probably benign Het
Atp10d T C 5: 72,246,946 probably benign Het
Baiap3 A G 17: 25,249,373 S264P probably damaging Het
BC055324 T C 1: 163,962,085 N627S probably damaging Het
Brinp3 A T 1: 146,901,746 I644F probably benign Het
Ccdc66 T C 14: 27,486,741 R675G probably benign Het
Cnr2 T G 4: 135,916,689 M26R probably damaging Het
Col6a2 A T 10: 76,609,251 probably null Het
Cux1 A G 5: 136,308,184 W696R probably damaging Het
D6Ertd527e A G 6: 87,111,206 N117S unknown Het
Dnah12 T C 14: 26,815,495 C2234R probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock2 T G 11: 34,249,836 I1405L probably benign Het
Enoph1 T C 5: 100,062,277 probably null Het
Epha10 A T 4: 124,902,566 Q356L unknown Het
Fbln2 G T 6: 91,271,796 V1148L probably damaging Het
Gm11397 G A 13: 33,395,829 C20Y probably damaging Het
Gm8251 A T 1: 44,061,464 V158D possibly damaging Het
Gp2 C T 7: 119,452,294 V233M possibly damaging Het
Gtf2ird1 T A 5: 134,363,318 S800C probably damaging Het
Hat1 A G 2: 71,434,209 probably null Het
Hpdl A T 4: 116,820,842 S141T probably benign Het
Klhl29 A G 12: 5,090,669 S658P possibly damaging Het
Lifr T A 15: 7,191,084 I1065N probably damaging Het
Lrrn2 G T 1: 132,937,161 probably benign Het
March9 T A 10: 127,058,303 I144F probably benign Het
Mtnr1a A G 8: 45,087,937 I312V possibly damaging Het
Ngf T A 3: 102,520,353 F139L probably damaging Het
Nipbl T C 15: 8,301,382 I2318V probably benign Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nphs1 A G 7: 30,486,625 D1227G probably benign Het
Olfm3 C A 3: 115,122,275 N285K probably benign Het
Olfr1313 T A 2: 112,072,377 I69F probably benign Het
Olfr3 C A 2: 36,812,681 S137I probably benign Het
Olfr855 G A 9: 19,584,899 D121N probably damaging Het
Olfr870 A G 9: 20,170,795 Y259H probably damaging Het
Olfr887 C T 9: 38,085,631 S265F possibly damaging Het
Osbp2 A G 11: 3,863,486 S128P probably benign Het
Otop2 A T 11: 115,326,859 M174L probably damaging Het
Pard3 A G 8: 127,389,433 T668A possibly damaging Het
Pkhd1 T C 1: 20,547,461 T967A possibly damaging Het
Pls1 A G 9: 95,787,012 V52A probably damaging Het
Ptcd3 T C 6: 71,907,659 K64R probably damaging Het
Pxn T C 5: 115,544,534 W69R possibly damaging Het
Rai14 T C 15: 10,575,120 D584G probably damaging Het
Safb G A 17: 56,599,000 probably benign Het
Serinc2 A C 4: 130,265,076 L10R probably damaging Het
Serpinb12 A T 1: 106,946,701 H52L probably benign Het
Serpinf2 A G 11: 75,435,939 Y273H probably damaging Het
Slc2a10 T A 2: 165,514,740 S107T probably benign Het
Slc41a3 T C 6: 90,640,946 L318P probably damaging Het
Slc6a3 A T 13: 73,538,735 I74F probably damaging Het
Snrnp200 G A 2: 127,225,135 G788D probably damaging Het
Snx7 A G 3: 117,846,623 I79T probably benign Het
Sox11 G T 12: 27,341,824 D195E probably benign Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Tab2 A G 10: 7,920,073 I215T probably damaging Het
Ttn C T 2: 76,830,598 V7422I possibly damaging Het
Unc13c A T 9: 73,546,075 probably null Het
Wdr17 T C 8: 54,662,869 D633G probably damaging Het
Wdsub1 A T 2: 59,852,895 M445K probably damaging Het
Xpc A G 6: 91,504,120 F257L probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTCATGTGTGGATTATTGTC -3'
(R):5'- AGGCATTCTCAGAAATTACTGTGG -3'

Sequencing Primer
(F):5'- GTGTTCAAAGTGCACTATTTTAAGC -3'
(R):5'- CAGAAATTACTGTGGTCTTGCC -3'
Posted On2016-11-09