Incidental Mutation 'R5682:Pigc'
ID443075
Institutional Source Beutler Lab
Gene Symbol Pigc
Ensembl Gene ENSMUSG00000026698
Gene Namephosphatidylinositol glycan anchor biosynthesis, class C
Synonyms3110030E07Rik
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161969186-161973435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161970947 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 166 (Y166C)
Ref Sequence ENSEMBL: ENSMUSP00000141646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028021] [ENSMUST00000111594] [ENSMUST00000159648] [ENSMUST00000160881] [ENSMUST00000162676] [ENSMUST00000193784]
Predicted Effect probably damaging
Transcript: ENSMUST00000028021
AA Change: Y166C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028021
Gene: ENSMUSG00000026698
AA Change: Y166C

DomainStartEndE-ValueType
Pfam:GPI2 14 284 6.2e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111594
AA Change: Y166C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107221
Gene: ENSMUSG00000026698
AA Change: Y166C

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141397
Predicted Effect probably benign
Transcript: ENSMUST00000159648
Predicted Effect probably benign
Transcript: ENSMUST00000160881
SMART Domains Protein: ENSMUSP00000125321
Gene: ENSMUSG00000026698

DomainStartEndE-ValueType
Pfam:GPI2 14 140 2.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161826
Predicted Effect probably benign
Transcript: ENSMUST00000162676
SMART Domains Protein: ENSMUSP00000124751
Gene: ENSMUSG00000086277

DomainStartEndE-ValueType
Pfam:DUF4548 17 181 1.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193784
AA Change: Y166C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141646
Gene: ENSMUSG00000026698
AA Change: Y166C

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Pigc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01725:Pigc APN 1 161971345 utr 3 prime probably benign
IGL02009:Pigc APN 1 161970565 missense probably damaging 1.00
IGL02586:Pigc APN 1 161970934 missense probably benign 0.02
IGL03095:Pigc APN 1 161970776 missense possibly damaging 0.79
IGL03109:Pigc APN 1 161970776 missense possibly damaging 0.79
apocryphon UTSW 1 161971094 missense probably benign 0.21
pistis UTSW 1 161970947 missense probably damaging 0.99
R0321:Pigc UTSW 1 161971099 nonsense probably null
R1450:Pigc UTSW 1 161971253 missense probably benign 0.01
R1708:Pigc UTSW 1 161970724 missense probably benign 0.00
R1857:Pigc UTSW 1 161970877 missense possibly damaging 0.90
R1875:Pigc UTSW 1 161970947 missense probably damaging 0.99
R2371:Pigc UTSW 1 161971010 missense possibly damaging 0.72
R2940:Pigc UTSW 1 161970670 missense possibly damaging 0.96
R3706:Pigc UTSW 1 161971094 missense probably benign 0.21
R3707:Pigc UTSW 1 161971094 missense probably benign 0.21
R3708:Pigc UTSW 1 161971094 missense probably benign 0.21
R3725:Pigc UTSW 1 161971291 missense possibly damaging 0.95
R5193:Pigc UTSW 1 161970896 missense possibly damaging 0.91
R6228:Pigc UTSW 1 161970467 missense probably benign 0.03
R7143:Pigc UTSW 1 161970592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCATCTTCCTTGGTTG -3'
(R):5'- TGACCCCTACATAGCTTCGC -3'

Sequencing Primer
(F):5'- ATCTTATCGATGGAGGTGATGGAC -3'
(R):5'- CTACATAGCTTCGCGGGGTGTAC -3'
Posted On2016-11-09