Incidental Mutation 'R5682:Mpz'
ID443076
Institutional Source Beutler Lab
Gene Symbol Mpz
Ensembl Gene ENSMUSG00000056569
Gene Namemyelin protein zero
SynonymsMpp, P0
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171150711-171161130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171158894 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 126 (T126S)
Ref Sequence ENSEMBL: ENSMUSP00000106966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070758] [ENSMUST00000111334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070758
AA Change: T126S

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066701
Gene: ENSMUSG00000056569
AA Change: T126S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 184 248 4.3e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111334
AA Change: T126S

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106966
Gene: ENSMUSG00000056569
AA Change: T126S

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
IGv 45 129 1.39e-11 SMART
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Myelin-PO_C 179 248 4.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149352
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit premature death, infertility, neurological behavior defects, and demyelination. Mice homozygous for a knock-out allele exhibit abnormal myelination and neurological behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Mpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Mpz APN 1 171160002 missense possibly damaging 0.84
IGL03051:Mpz APN 1 171158811 missense probably damaging 1.00
taz UTSW 1 171158810 missense probably damaging 1.00
R0279:Mpz UTSW 1 171159929 splice site probably benign
R0791:Mpz UTSW 1 171158774 missense possibly damaging 0.85
R1164:Mpz UTSW 1 171158439 missense possibly damaging 0.92
R1368:Mpz UTSW 1 171159964 missense probably damaging 1.00
R4043:Mpz UTSW 1 171159771 splice site probably benign
R4857:Mpz UTSW 1 171158810 missense probably damaging 1.00
R6709:Mpz UTSW 1 171150732 unclassified probably benign
R7089:Mpz UTSW 1 171159635 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGGAGCTTTTCACACTAGG -3'
(R):5'- AACCTTGCTTATCTGCCGG -3'

Sequencing Primer
(F):5'- GGAGCTTTTCACACTAGGATTCTTTC -3'
(R):5'- GTTAAAGGCTTGCACCACCTG -3'
Posted On2016-11-09