Incidental Mutation 'R5682:Siglec1'
ID443084
Institutional Source Beutler Lab
Gene Symbol Siglec1
Ensembl Gene ENSMUSG00000027322
Gene Namesialic acid binding Ig-like lectin 1, sialoadhesin
SynonymsSn, CD169, Siglec-1
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131069220-131086765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131084010 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 259 (I259F)
Ref Sequence ENSEMBL: ENSMUSP00000105856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110226] [ENSMUST00000110227]
Predicted Effect probably damaging
Transcript: ENSMUST00000028794
AA Change: I259F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: I259F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 9.4e-18 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
IG_like 1549 1624 1.21e-1 SMART
transmembrane domain 1647 1669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110226
AA Change: I259F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105855
Gene: ENSMUSG00000027322
AA Change: I259F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7.7e-18 PFAM
IGc2 260 319 8.78e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110227
AA Change: I259F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: I259F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7e-17 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Siglec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Siglec1 APN 2 131079325 missense probably benign 0.03
IGL01092:Siglec1 APN 2 131079217 missense probably damaging 1.00
IGL01115:Siglec1 APN 2 131074502 missense probably benign 0.01
IGL01324:Siglec1 APN 2 131085541 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131083536 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131075005 nonsense probably null
IGL01558:Siglec1 APN 2 131078499 missense probably damaging 0.96
IGL01632:Siglec1 APN 2 131083820 missense probably benign 0.03
IGL01768:Siglec1 APN 2 131074394 missense probably benign
IGL02399:Siglec1 APN 2 131071178 missense probably benign 0.16
IGL02558:Siglec1 APN 2 131074995 missense possibly damaging 0.88
IGL02794:Siglec1 APN 2 131075969 missense possibly damaging 0.86
IGL02839:Siglec1 APN 2 131084932 missense possibly damaging 0.82
K3955:Siglec1 UTSW 2 131081439 missense probably benign 0.00
P0038:Siglec1 UTSW 2 131081439 missense probably benign 0.00
PIT4576001:Siglec1 UTSW 2 131078161 missense probably damaging 1.00
PIT4677001:Siglec1 UTSW 2 131072757 missense probably damaging 1.00
R0003:Siglec1 UTSW 2 131075060 missense probably benign 0.00
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0243:Siglec1 UTSW 2 131085476 missense probably damaging 1.00
R0276:Siglec1 UTSW 2 131083941 nonsense probably null
R0379:Siglec1 UTSW 2 131074525 splice site probably benign
R0464:Siglec1 UTSW 2 131079359 missense probably damaging 1.00
R0507:Siglec1 UTSW 2 131074525 splice site probably benign
R0560:Siglec1 UTSW 2 131070346 missense probably benign 0.02
R0620:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0621:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0853:Siglec1 UTSW 2 131085022 missense probably damaging 0.98
R1079:Siglec1 UTSW 2 131079377 nonsense probably null
R1169:Siglec1 UTSW 2 131074827 missense probably damaging 0.97
R1205:Siglec1 UTSW 2 131080464 missense possibly damaging 0.94
R1293:Siglec1 UTSW 2 131073531 missense probably benign 0.00
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1533:Siglec1 UTSW 2 131076158 missense probably benign
R1717:Siglec1 UTSW 2 131073956 missense possibly damaging 0.92
R1717:Siglec1 UTSW 2 131084012 missense probably damaging 1.00
R1744:Siglec1 UTSW 2 131081299 missense probably damaging 1.00
R1852:Siglec1 UTSW 2 131081500 missense probably damaging 0.98
R1941:Siglec1 UTSW 2 131078131 missense possibly damaging 0.94
R2011:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2012:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2128:Siglec1 UTSW 2 131080497 missense probably damaging 1.00
R2278:Siglec1 UTSW 2 131071337 missense probably benign 0.28
R2403:Siglec1 UTSW 2 131074475 missense possibly damaging 0.65
R2449:Siglec1 UTSW 2 131078725 missense probably benign 0.44
R2885:Siglec1 UTSW 2 131072747 missense possibly damaging 0.88
R4213:Siglec1 UTSW 2 131074118 missense probably damaging 1.00
R4274:Siglec1 UTSW 2 131085814 missense probably benign 0.00
R4679:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R4715:Siglec1 UTSW 2 131074436 missense probably damaging 1.00
R4782:Siglec1 UTSW 2 131075923 missense probably damaging 1.00
R4896:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R4993:Siglec1 UTSW 2 131073361 missense possibly damaging 0.93
R5004:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R5004:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R5105:Siglec1 UTSW 2 131080400 missense possibly damaging 0.69
R5137:Siglec1 UTSW 2 131081344 missense probably damaging 1.00
R5153:Siglec1 UTSW 2 131085577 missense probably damaging 0.99
R5311:Siglec1 UTSW 2 131079316 missense probably damaging 1.00
R5600:Siglec1 UTSW 2 131085583 missense probably benign 0.01
R5732:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R5870:Siglec1 UTSW 2 131072847 missense probably damaging 0.99
R5898:Siglec1 UTSW 2 131073633 missense probably damaging 1.00
R5909:Siglec1 UTSW 2 131077964 missense probably damaging 1.00
R6488:Siglec1 UTSW 2 131081307 missense probably damaging 0.99
R6920:Siglec1 UTSW 2 131078077 nonsense probably null
R7064:Siglec1 UTSW 2 131083914 missense probably benign 0.00
R7270:Siglec1 UTSW 2 131081551 missense possibly damaging 0.67
X0024:Siglec1 UTSW 2 131080491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATCATTTGTTGCTTGGCAG -3'
(R):5'- ATGGGCCAAGCACCACATTC -3'

Sequencing Primer
(F):5'- AGGTGTAGGCCCCAGAATCATTC -3'
(R):5'- ACATTCCCAGGGCCTCATG -3'
Posted On2016-11-09