Incidental Mutation 'R5682:Sgms2'
ID443089
Institutional Source Beutler Lab
Gene Symbol Sgms2
Ensembl Gene ENSMUSG00000050931
Gene Namesphingomyelin synthase 2
Synonyms4933405A16Rik, 5133401H06Rik
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5682 (G1)
Quality Score212
Status Not validated
Chromosome3
Chromosomal Location131318985-131491411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131324962 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 291 (Y291H)
Ref Sequence ENSEMBL: ENSMUSP00000087713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090246]
Predicted Effect probably damaging
Transcript: ENSMUST00000090246
AA Change: Y291H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087713
Gene: ENSMUSG00000050931
AA Change: Y291H

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:PAP2_C 220 293 5.5e-29 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ceramide levels; decreased sphingomyelin, sphingomyelin-1-phosphate, and diacylglycerol levels; and resistance to lysenin-mediated cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Sgms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Sgms2 APN 3 131341833 missense possibly damaging 0.91
IGL01839:Sgms2 APN 3 131342102 missense possibly damaging 0.92
IGL02232:Sgms2 APN 3 131323184 missense probably benign
R0602:Sgms2 UTSW 3 131325107 critical splice acceptor site probably null
R2183:Sgms2 UTSW 3 131336285 splice site probably null
R4393:Sgms2 UTSW 3 131341817 unclassified probably null
R4457:Sgms2 UTSW 3 131325016 missense probably damaging 1.00
R5050:Sgms2 UTSW 3 131330356 missense probably benign
R5052:Sgms2 UTSW 3 131330356 missense probably benign
R5088:Sgms2 UTSW 3 131330356 missense probably benign
R5224:Sgms2 UTSW 3 131342117 missense probably damaging 0.98
R5426:Sgms2 UTSW 3 131341797 missense probably benign 0.01
R5735:Sgms2 UTSW 3 131336217 missense probably damaging 1.00
R6892:Sgms2 UTSW 3 131342154 missense probably benign
R7149:Sgms2 UTSW 3 131336259 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CACAGCATGTATGTTTGTGAAGTTC -3'
(R):5'- TGCTGGAATCGTGCTGACTG -3'

Sequencing Primer
(F):5'- CTGCGGCTTTTAAAATAAGCGGC -3'
(R):5'- GGAATCGTGCTGACTGTTATCTCTC -3'
Posted On2016-11-09