Incidental Mutation 'R5682:Helq'
ID443098
Institutional Source Beutler Lab
Gene Symbol Helq
Ensembl Gene ENSMUSG00000035266
Gene Namehelicase, POLQ-like
SynonymsD430018E21Rik, Hel308
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100762145-100798598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100785304 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 555 (M555L)
Ref Sequence ENSEMBL: ENSMUSP00000041599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044684] [ENSMUST00000151201]
Predicted Effect probably benign
Transcript: ENSMUST00000044684
AA Change: M555L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041599
Gene: ENSMUSG00000035266
AA Change: M555L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
DEXDc 291 486 3.05e-17 SMART
HELICc 585 671 2.54e-14 SMART
low complexity region 812 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133845
AA Change: M553L
SMART Domains Protein: ENSMUSP00000116470
Gene: ENSMUSG00000035266
AA Change: M553L

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
DEXDc 290 485 3.05e-17 SMART
HELICc 584 670 2.54e-14 SMART
low complexity region 811 826 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151201
SMART Domains Protein: ENSMUSP00000118493
Gene: ENSMUSG00000035266

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198409
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase (Marini and Wood, 2002 [PubMed 11751861]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced fertility and increased incident of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Helq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Helq APN 5 100765082 unclassified probably benign
IGL02142:Helq APN 5 100783094 missense probably benign 0.01
IGL02172:Helq APN 5 100790147 missense probably damaging 1.00
IGL02234:Helq APN 5 100796470 missense possibly damaging 0.93
IGL03086:Helq APN 5 100796927 missense possibly damaging 0.60
R0083:Helq UTSW 5 100768368 nonsense probably null
R0108:Helq UTSW 5 100768368 nonsense probably null
R0276:Helq UTSW 5 100790147 missense probably damaging 1.00
R0359:Helq UTSW 5 100790200 missense probably benign 0.01
R0383:Helq UTSW 5 100779165 missense probably benign 0.28
R0554:Helq UTSW 5 100790200 missense probably benign 0.01
R1289:Helq UTSW 5 100796464 missense probably damaging 1.00
R1682:Helq UTSW 5 100792813 missense probably benign 0.41
R1800:Helq UTSW 5 100774124 missense probably benign 0.34
R1809:Helq UTSW 5 100773954 missense probably damaging 0.97
R1838:Helq UTSW 5 100771879 nonsense probably null
R3086:Helq UTSW 5 100773992 missense probably benign
R3439:Helq UTSW 5 100798304 missense probably damaging 0.97
R3735:Helq UTSW 5 100790188 missense possibly damaging 0.64
R3736:Helq UTSW 5 100790188 missense possibly damaging 0.64
R4172:Helq UTSW 5 100771847 missense probably benign 0.03
R4835:Helq UTSW 5 100774163 missense possibly damaging 0.82
R4855:Helq UTSW 5 100783159 missense possibly damaging 0.89
R4908:Helq UTSW 5 100762641 splice site probably null
R4973:Helq UTSW 5 100792871 intron probably benign
R5561:Helq UTSW 5 100787050 missense probably benign 0.06
R5583:Helq UTSW 5 100762593 missense probably damaging 0.99
R5608:Helq UTSW 5 100790219 missense probably damaging 1.00
R5875:Helq UTSW 5 100796470 missense probably damaging 1.00
R6302:Helq UTSW 5 100798439 missense probably damaging 0.96
R6344:Helq UTSW 5 100766728 missense probably benign 0.27
R6446:Helq UTSW 5 100768384 missense possibly damaging 0.64
R6825:Helq UTSW 5 100792695 missense probably damaging 1.00
R7260:Helq UTSW 5 100791927 missense probably damaging 1.00
R7323:Helq UTSW 5 100783185 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTGGTCGCTCTCTTACAAC -3'
(R):5'- AGATACTGGTGATGGTTTACATGTC -3'

Sequencing Primer
(F):5'- CATTAGTGCGAATTTCAGTTAGGC -3'
(R):5'- GTCTTTCAAGTCACAATTCGTTGTTG -3'
Posted On2016-11-09