Incidental Mutation 'R5682:Sds'
ID443099
Institutional Source Beutler Lab
Gene Symbol Sds
Ensembl Gene ENSMUSG00000029597
Gene Nameserine dehydratase
SynonymsSDH
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5682 (G1)
Quality Score121
Status Not validated
Chromosome5
Chromosomal Location120476526-120483932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120483719 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 309 (S309R)
Ref Sequence ENSEMBL: ENSMUSP00000143838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031597] [ENSMUST00000066540] [ENSMUST00000111898] [ENSMUST00000201684]
Predicted Effect probably benign
Transcript: ENSMUST00000031597
SMART Domains Protein: ENSMUSP00000031597
Gene: ENSMUSG00000029598

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Phospholip_B 62 591 2.9e-179 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066540
AA Change: S309R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064849
Gene: ENSMUSG00000029597
AA Change: S309R

DomainStartEndE-ValueType
Pfam:PALP 5 304 1.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111898
SMART Domains Protein: ENSMUSP00000107529
Gene: ENSMUSG00000029597

DomainStartEndE-ValueType
Pfam:PALP 5 101 2.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151361
Predicted Effect possibly damaging
Transcript: ENSMUST00000201684
AA Change: S309R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143838
Gene: ENSMUSG00000029597
AA Change: S309R

DomainStartEndE-ValueType
Pfam:PALP 5 304 1.5e-76 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Sds is the serine dehydratase structural gene. Albino region deletions profoundly affect development and expression of some gluconeogenic enzymes, including Sds. In these deletion mice, Sds is expressed normally on the constitutive level, but fails to develop hormone-inducible expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Sds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01715:Sds APN 5 120479207 nonsense probably null
R2567:Sds UTSW 5 120481581 missense probably damaging 1.00
R5490:Sds UTSW 5 120483650 missense possibly damaging 0.62
R6888:Sds UTSW 5 120480900 critical splice donor site probably null
R6958:Sds UTSW 5 120481472 missense probably damaging 0.98
R7030:Sds UTSW 5 120480825 missense probably benign
R7036:Sds UTSW 5 120480847 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATAGGGAGATGTTGAGAGCTTACC -3'
(R):5'- ACCACTTCTCTGAGAGCCAG -3'

Sequencing Primer
(F):5'- GCTTACCAGCCGCCTCC -3'
(R):5'- AGGATCTCCAGTTTGAGACCAGC -3'
Posted On2016-11-09