Incidental Mutation 'R5682:Limk1'
ID443101
Institutional Source Beutler Lab
Gene Symbol Limk1
Ensembl Gene ENSMUSG00000029674
Gene NameLIM-domain containing, protein kinase
Synonyms
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134656039-134688598 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 134665205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015137] [ENSMUST00000111233] [ENSMUST00000138590]
Predicted Effect probably null
Transcript: ENSMUST00000015137
SMART Domains Protein: ENSMUSP00000015137
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 24 75 5.3e-19 SMART
LIM 83 137 1.73e-9 SMART
PDZ 176 258 1.51e-9 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:Pkinase 339 604 1.7e-49 PFAM
Pfam:Pkinase_Tyr 339 604 1.5e-55 PFAM
Pfam:Kdo 345 509 2.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111233
SMART Domains Protein: ENSMUSP00000106864
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 23 67 2.19e-1 SMART
LIM 75 129 1.73e-9 SMART
PDZ 168 250 1.51e-9 SMART
low complexity region 258 269 N/A INTRINSIC
Pfam:Pkinase_Tyr 331 596 1.5e-56 PFAM
Pfam:Pkinase 331 597 4.7e-50 PFAM
Pfam:Kdo 339 501 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132027
Predicted Effect probably benign
Transcript: ENSMUST00000134093
SMART Domains Protein: ENSMUSP00000121718
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 16 60 2.19e-1 SMART
LIM 68 122 1.73e-9 SMART
PDZ 161 243 1.51e-9 SMART
low complexity region 251 262 N/A INTRINSIC
Pfam:Pkinase 324 425 3.9e-16 PFAM
Pfam:Pkinase_Tyr 324 434 5.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137897
Predicted Effect probably benign
Transcript: ENSMUST00000138590
SMART Domains Protein: ENSMUSP00000118268
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
Pfam:Pkinase 3 59 3.6e-9 PFAM
Pfam:Pkinase_Tyr 3 80 2.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the LIM kinase family of proteins. This protein is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein also stimulates axon growth and may play a role in brain development. Homozygous knockout mice for this gene exhibit reduced bone mass, abnormal neuronal morphology and altered synaptic function. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal actin cytoskeleton in neurons of the central nervous system and structural abnormalities of the dendritic spines. Long term potentiation is altered and behavioral anomalies are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Limk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Limk1 APN 5 134657900 unclassified probably benign
IGL02029:Limk1 APN 5 134657954 nonsense probably null
IGL02211:Limk1 APN 5 134657637 missense probably damaging 1.00
IGL03000:Limk1 APN 5 134670501 missense probably damaging 0.99
extremist UTSW 5 134670441 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0071:Limk1 UTSW 5 134661391 missense probably benign 0.01
R0180:Limk1 UTSW 5 134669261 missense probably damaging 0.97
R1456:Limk1 UTSW 5 134657510 missense probably benign 0.09
R2225:Limk1 UTSW 5 134661556 splice site probably null
R2379:Limk1 UTSW 5 134679481 unclassified probably benign
R2899:Limk1 UTSW 5 134688300 intron probably null
R3423:Limk1 UTSW 5 134672669 critical splice donor site probably null
R4235:Limk1 UTSW 5 134670478 missense probably benign 0.00
R4516:Limk1 UTSW 5 134676786 intron probably benign
R4566:Limk1 UTSW 5 134686683 missense probably benign 0.12
R4752:Limk1 UTSW 5 134670441 missense probably damaging 1.00
R5917:Limk1 UTSW 5 134657935 missense probably damaging 1.00
R6163:Limk1 UTSW 5 134657955 missense probably damaging 1.00
R6479:Limk1 UTSW 5 134661519 utr 3 prime probably benign
R6952:Limk1 UTSW 5 134670478 missense possibly damaging 0.76
R7009:Limk1 UTSW 5 134672699 missense probably benign
R7147:Limk1 UTSW 5 134657341 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTGAGTCCTCTAGCAGGGT -3'
(R):5'- TGGACAGATTGAGAACTTTGTGG -3'

Sequencing Primer
(F):5'- TCCTCTAGCAGGGTAGGCAAC -3'
(R):5'- GTAAACCTCTCAAGTACTGGGGTC -3'
Posted On2016-11-09