Incidental Mutation 'R5682:Ing3'
ID443104
Institutional Source Beutler Lab
Gene Symbol Ing3
Ensembl Gene ENSMUSG00000029670
Gene Nameinhibitor of growth family, member 3
Synonyms1300013A07Rik, P47ING3
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location21949571-21976038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21968950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 144 (S144P)
Ref Sequence ENSEMBL: ENSMUSP00000120651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031680] [ENSMUST00000115389] [ENSMUST00000136200] [ENSMUST00000149728] [ENSMUST00000151473] [ENSMUST00000152877]
Predicted Effect probably benign
Transcript: ENSMUST00000031680
AA Change: S168P

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031680
Gene: ENSMUSG00000029670
AA Change: S168P

DomainStartEndE-ValueType
Pfam:ING 3 104 2.7e-31 PFAM
low complexity region 214 239 N/A INTRINSIC
low complexity region 308 345 N/A INTRINSIC
PHD 365 410 4e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115389
AA Change: S157P

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111047
Gene: ENSMUSG00000029670
AA Change: S157P

DomainStartEndE-ValueType
Pfam:ING 2 104 1.5e-33 PFAM
low complexity region 203 228 N/A INTRINSIC
low complexity region 297 334 N/A INTRINSIC
PHD 354 399 6.39e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136161
AA Change: I156T
Predicted Effect probably benign
Transcript: ENSMUST00000136200
SMART Domains Protein: ENSMUSP00000138656
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 41 1.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144534
Predicted Effect probably benign
Transcript: ENSMUST00000149728
SMART Domains Protein: ENSMUSP00000145391
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 1 89 6.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151473
AA Change: S144P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120651
Gene: ENSMUSG00000029670
AA Change: S144P

DomainStartEndE-ValueType
Pfam:ING 2 80 1.9e-19 PFAM
low complexity region 190 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152877
SMART Domains Protein: ENSMUSP00000138244
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 89 1.5e-27 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Ing3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Ing3 APN 6 21968880 splice site probably benign
IGL02330:Ing3 APN 6 21952121 missense probably benign 0.00
IGL02668:Ing3 APN 6 21950059 missense probably damaging 0.98
IGL02897:Ing3 APN 6 21969326 missense probably benign 0.14
IGL03065:Ing3 APN 6 21971222 missense probably benign
R0076:Ing3 UTSW 6 21952171 missense probably benign
R0513:Ing3 UTSW 6 21970035 missense probably damaging 0.98
R0711:Ing3 UTSW 6 21971237 nonsense probably null
R2369:Ing3 UTSW 6 21950091 missense probably damaging 0.98
R4660:Ing3 UTSW 6 21973711 utr 3 prime probably benign
R4672:Ing3 UTSW 6 21965730 splice site probably null
R5557:Ing3 UTSW 6 21968909 missense possibly damaging 0.95
R5773:Ing3 UTSW 6 21971835 missense probably damaging 1.00
R5774:Ing3 UTSW 6 21967689 missense probably benign
R5914:Ing3 UTSW 6 21968905 missense probably benign 0.18
R5976:Ing3 UTSW 6 21971174 missense probably benign 0.09
R6265:Ing3 UTSW 6 21953814 missense probably damaging 0.99
R7239:Ing3 UTSW 6 21952194 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAACCACGTGACAAAGACTG -3'
(R):5'- ATCATCATGTAGACTTCAGAGGTAGC -3'

Sequencing Primer
(F):5'- GGTGAGCATAATGGTCCATTTCAC -3'
(R):5'- ACTTCAGAGGTAGCACATGTG -3'
Posted On2016-11-09