Incidental Mutation 'R5682:Tmprss9'
ID443135
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Nametransmembrane protease, serine 9
SynonymsSerase-1B
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5682 (G1)
Quality Score221
Status Not validated
Chromosome10
Chromosomal Location80871848-80899492 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 80897373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105333] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219817] [ENSMUST00000219896]
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057623
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105333
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179022
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218149
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Predicted Effect probably null
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80894428 critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80892292 missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80897959 unclassified probably benign
IGL03075:Tmprss9 APN 10 80884029 missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80894865 missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80894378 missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80899323 missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80879858 missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80890445 missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80895129 missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80895100 missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80898187 unclassified probably benign
R1851:Tmprss9 UTSW 10 80892285 missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80889434 missense probably damaging 1.00
R2198:Tmprss9 UTSW 10 80887459 missense probably damaging 1.00
R3783:Tmprss9 UTSW 10 80887467 missense probably damaging 1.00
R5868:Tmprss9 UTSW 10 80882746 missense probably benign 0.03
R6006:Tmprss9 UTSW 10 80883721 missense possibly damaging 0.92
R6542:Tmprss9 UTSW 10 80888555 missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80898311 unclassified probably benign
R6718:Tmprss9 UTSW 10 80890364 missense probably benign
R7062:Tmprss9 UTSW 10 80895049 missense probably benign 0.00
R7316:Tmprss9 UTSW 10 80894979 missense probably benign 0.00
X0062:Tmprss9 UTSW 10 80883938 splice site probably null
X0066:Tmprss9 UTSW 10 80893230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATTTGCTCTTCTACAGATTGTGGC -3'
(R):5'- CCCCAGTCATTTCTACTAGGGC -3'

Sequencing Primer
(F):5'- TCTACAGATTGTGGCCTGGCAC -3'
(R):5'- CTGGGTGCTCAACTTTCCAGAG -3'
Posted On2016-11-09