Incidental Mutation 'R5682:Avil'
ID443138
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Nameadvillin
SynonymsDOC6
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127000709-127020994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 127014104 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 608 (Q608P)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]
Predicted Effect probably damaging
Transcript: ENSMUST00000026500
AA Change: Q608P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: Q608P

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129173
AA Change: Q608P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: Q608P

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 unclassified probably null
R2026:Avil UTSW 10 127011873 missense probably damaging 1.00
R3694:Avil UTSW 10 127008330 missense probably damaging 0.98
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5285:Avil UTSW 10 127018459 missense probably damaging 0.97
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6745:Avil UTSW 10 127014119 missense probably benign 0.00
R6804:Avil UTSW 10 127008306 nonsense probably null
R6838:Avil UTSW 10 127013562 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAGATTCCCTCACAGC -3'
(R):5'- ATCCTGAACTTTGCGGCTG -3'

Sequencing Primer
(F):5'- CTGGTGGCCTAGTCTAACCAAATG -3'
(R):5'- GAACTTTGCGGCTGTGTCTTACC -3'
Posted On2016-11-09