Incidental Mutation 'R5682:Abcc3'
ID443140
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 3
SynonymsMRP3, 1700019L09Rik
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94343295-94392997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94392897 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 7 (S7T)
Ref Sequence ENSEMBL: ENSMUSP00000136343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]
Predicted Effect probably benign
Transcript: ENSMUST00000021231
AA Change: S7T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: S7T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151124
Predicted Effect probably benign
Transcript: ENSMUST00000178136
AA Change: S7T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: S7T

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1269:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1375:Abcc3 UTSW 11 94352216 missense possibly damaging 0.46
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4425:Abcc3 UTSW 11 94346044 missense probably damaging 0.98
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R4877:Abcc3 UTSW 11 94367595 missense probably damaging 0.98
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R6953:Abcc3 UTSW 11 94374835 missense probably benign 0.03
R7054:Abcc3 UTSW 11 94365225 missense probably benign 0.01
R7131:Abcc3 UTSW 11 94365031 missense probably damaging 1.00
R7210:Abcc3 UTSW 11 94373941 missense probably benign 0.03
R7283:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7284:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7285:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7287:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7320:Abcc3 UTSW 11 94367645 missense probably benign 0.33
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAGGTCTGACTATGCAC -3'
(R):5'- TAGGTACCAGCACTTTTACCAAGG -3'

Sequencing Primer
(F):5'- AGGTCTGACTATGCACATCCG -3'
(R):5'- ACCAAGGCTGTGTTGCAATC -3'
Posted On2016-11-09