Incidental Mutation 'R5682:Acot4'
ID443147
Institutional Source Beutler Lab
Gene Symbol Acot4
Ensembl Gene ENSMUSG00000052392
Gene Nameacyl-CoA thioesterase 4
SynonymsB430212I04Rik, Pte2b, PTE-Ib
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5682 (G1)
Quality Score209
Status Not validated
Chromosome12
Chromosomal Location84038379-84048601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84038802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 98 (V98M)
Ref Sequence ENSEMBL: ENSMUSP00000021652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021652]
Predicted Effect probably damaging
Transcript: ENSMUST00000021652
AA Change: V98M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021652
Gene: ENSMUSG00000052392
AA Change: V98M

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 3.4e-43 PFAM
low complexity region 148 159 N/A INTRINSIC
Pfam:Abhydrolase_5 162 361 1e-6 PFAM
Pfam:FSH1 193 364 3.5e-5 PFAM
Pfam:BAAT_C 203 412 1.1e-82 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000128162
AA Change: V32M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180751
Predicted Effect probably benign
Transcript: ENSMUST00000221229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221860
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Sgsm3 A G 15: 81,011,460 probably null Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Acot4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Acot4 APN 12 84042025 missense probably damaging 0.98
IGL02806:Acot4 APN 12 84041963 missense probably damaging 1.00
IGL02967:Acot4 APN 12 84043461 missense probably benign
R1827:Acot4 UTSW 12 84041938 missense probably damaging 1.00
R2105:Acot4 UTSW 12 84038742 missense probably damaging 1.00
R2509:Acot4 UTSW 12 84041873 missense probably damaging 1.00
R2904:Acot4 UTSW 12 84043603 missense probably benign 0.31
R3859:Acot4 UTSW 12 84043444 missense probably benign 0.17
R3904:Acot4 UTSW 12 84043327 unclassified probably null
R4190:Acot4 UTSW 12 84043174 intron probably benign
R4192:Acot4 UTSW 12 84043174 intron probably benign
R4541:Acot4 UTSW 12 84043248 missense probably benign 0.38
R5061:Acot4 UTSW 12 84038701 missense probably benign 0.03
R5864:Acot4 UTSW 12 84043404 missense probably benign 0.04
R6818:Acot4 UTSW 12 84042009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGTCTGGGTCCTAGAGAC -3'
(R):5'- TGGCCAATAGCACCTTCCTAG -3'

Sequencing Primer
(F):5'- AGCTCCTAATGGCAGCGAC -3'
(R):5'- CCCTAGACTCAGCCCTTGG -3'
Posted On2016-11-09