Incidental Mutation 'R5682:Sgsm3'
ID443155
Institutional Source Beutler Lab
Gene Symbol Sgsm3
Ensembl Gene ENSMUSG00000042303
Gene Namesmall G protein signaling modulator 3
SynonymsCIP85, Rutbc3, 1810012I01Rik
MMRRC Submission 043318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R5682 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80977765-81012290 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 81011460 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000137255] [ENSMUST00000139517] [ENSMUST00000143147] [ENSMUST00000149582] [ENSMUST00000228971] [ENSMUST00000229727]
PDB Structure
Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000042506
SMART Domains Protein: ENSMUSP00000043311
Gene: ENSMUSG00000103565

DomainStartEndE-ValueType
TBC 121 338 3.6e-62 SMART
low complexity region 391 401 N/A INTRINSIC
SH3 493 548 6.34e-19 SMART
RUN 664 726 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109579
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124845
Predicted Effect probably benign
Transcript: ENSMUST00000131235
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132039
Predicted Effect probably benign
Transcript: ENSMUST00000134469
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134559
Predicted Effect probably benign
Transcript: ENSMUST00000135047
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138550
Predicted Effect probably null
Transcript: ENSMUST00000139517
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149345
Predicted Effect probably benign
Transcript: ENSMUST00000149582
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154904
SMART Domains Protein: ENSMUSP00000118050
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
SH3 114 169 6.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156783
Predicted Effect probably benign
Transcript: ENSMUST00000228971
Predicted Effect probably benign
Transcript: ENSMUST00000229727
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,586 D642G probably damaging Het
Abcc3 A T 11: 94,392,897 S7T probably benign Het
Acot4 G A 12: 84,038,802 V98M probably damaging Het
Acsm2 A T 7: 119,563,551 N41I probably benign Het
Adamtsl3 A T 7: 82,606,550 N1590I probably damaging Het
Ank3 G A 10: 69,893,517 G714R probably damaging Het
Ash1l G A 3: 89,007,607 R1848Q probably damaging Het
Atp1a4 A T 1: 172,254,163 Y141N probably damaging Het
Atxn3 A T 12: 101,958,147 I1N probably damaging Het
Avil A C 10: 127,014,104 Q608P probably damaging Het
Axin1 T C 17: 26,187,801 V456A probably benign Het
Cacna1g A G 11: 94,459,114 L635P probably damaging Het
Card11 G A 5: 140,902,911 Q231* probably null Het
Ccdc162 G A 10: 41,556,803 R500* probably null Het
Cdh24 T C 14: 54,637,348 D400G probably damaging Het
Cep112 T C 11: 108,470,312 L164P probably damaging Het
Corin A G 5: 72,422,154 S224P possibly damaging Het
Csgalnact2 T C 6: 118,120,992 Y371C probably damaging Het
Cspg4 A T 9: 56,886,196 E405V probably benign Het
Ctnna3 T A 10: 64,873,306 M708K probably damaging Het
Cyp7a1 T A 4: 6,268,429 Y432F probably benign Het
Dcaf11 T A 14: 55,563,426 V113E probably damaging Het
Dhx29 T C 13: 112,930,849 I88T probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Elmo2 A G 2: 165,297,410 F406L probably damaging Het
Eps15l1 G A 8: 72,371,748 Q648* probably null Het
Fam171a1 G A 2: 3,226,089 R753Q probably damaging Het
Figla T A 6: 86,018,622 V86E probably damaging Het
Galnt7 C A 8: 57,583,933 E141* probably null Het
Garnl3 A G 2: 33,054,173 Y125H probably damaging Het
Gnb5 A G 9: 75,327,241 D74G probably damaging Het
Grk1 A T 8: 13,414,351 I408F possibly damaging Het
Has1 A T 17: 17,844,163 W405R possibly damaging Het
Hdac5 A G 11: 102,213,923 probably benign Het
Helq T A 5: 100,785,304 M555L probably benign Het
Hipk2 T C 6: 38,737,473 N556S possibly damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Ing3 T C 6: 21,968,950 S144P probably damaging Het
Itgb1 G A 8: 128,727,068 probably null Het
Kcnh4 A T 11: 100,749,802 M466K possibly damaging Het
Krit1 T A 5: 3,830,737 N565K probably damaging Het
Limk1 A C 5: 134,665,205 probably null Het
Lrif1 T C 3: 106,732,568 I323T possibly damaging Het
Macf1 T C 4: 123,434,759 E1811G probably damaging Het
Mctp2 A C 7: 72,245,459 probably null Het
Mmp21 A G 7: 133,674,629 I495T probably benign Het
Mpz A T 1: 171,158,894 T126S possibly damaging Het
Napsa A G 7: 44,585,344 Y301C possibly damaging Het
Ncbp1 T A 4: 46,170,474 probably benign Het
Nup160 A G 2: 90,679,811 E47G probably benign Het
Olfr923 A G 9: 38,828,128 I146V probably benign Het
Pcdha11 A G 18: 37,011,449 K198E probably damaging Het
Pcdha3 A G 18: 36,947,987 D594G probably damaging Het
Pdcd5 G A 7: 35,647,188 probably benign Het
Pdhx A T 2: 103,035,340 S166T probably benign Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Prkch C T 12: 73,697,950 H246Y probably damaging Het
Ptk2 A T 15: 73,262,564 L562* probably null Het
Rab3ip C T 10: 116,907,103 W439* probably null Het
Rasef T A 4: 73,740,971 R435* probably null Het
Rnf103 C T 6: 71,508,724 probably benign Het
Rtel1 T C 2: 181,349,972 F388L probably benign Het
Sds A C 5: 120,483,719 S309R possibly damaging Het
Sgip1 T A 4: 102,967,650 D736E possibly damaging Het
Sgms2 A G 3: 131,324,962 Y291H probably damaging Het
Siglec1 T A 2: 131,084,010 I259F probably damaging Het
Sik2 G A 9: 50,917,082 P220L probably damaging Het
Slc29a3 A G 10: 60,716,212 V351A probably benign Het
Slc36a3 A G 11: 55,125,663 S369P probably benign Het
Srgap1 A T 10: 121,805,014 M649K probably damaging Het
Thnsl1 A G 2: 21,212,068 E211G possibly damaging Het
Tmprss9 A G 10: 80,897,373 probably null Het
Tpgs1 G A 10: 79,675,587 V188M probably damaging Het
Vmn1r201 G T 13: 22,475,185 V190F probably damaging Het
Vmn1r64 A T 7: 5,883,623 L307Q possibly damaging Het
Wbp11 T C 6: 136,814,254 probably benign Het
Wdr35 A G 12: 8,981,125 Y134C probably damaging Het
Zan G T 5: 137,414,259 C3263* probably null Het
Zc3h12c G T 9: 52,126,576 D301E probably damaging Het
Zfp365 A C 10: 67,909,807 L47R probably damaging Het
Zmym6 C T 4: 127,104,407 P412L probably damaging Het
Other mutations in Sgsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Sgsm3 APN 15 81010852 unclassified probably benign
IGL03370:Sgsm3 APN 15 81011654 critical splice acceptor site probably null
R0109:Sgsm3 UTSW 15 81009466 missense probably damaging 0.99
R0267:Sgsm3 UTSW 15 81006602 missense probably damaging 0.96
R0382:Sgsm3 UTSW 15 81008314 nonsense probably null
R0441:Sgsm3 UTSW 15 81009770 missense possibly damaging 0.87
R0631:Sgsm3 UTSW 15 81011736 makesense probably null
R0905:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R1364:Sgsm3 UTSW 15 81007942 missense probably damaging 0.98
R1515:Sgsm3 UTSW 15 81010256 missense probably benign 0.08
R2226:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2227:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2414:Sgsm3 UTSW 15 81006745 missense probably benign 0.10
R2508:Sgsm3 UTSW 15 81003872 critical splice donor site probably null
R4240:Sgsm3 UTSW 15 81011782 unclassified probably benign
R4302:Sgsm3 UTSW 15 81010301 unclassified probably benign
R4899:Sgsm3 UTSW 15 81006779 missense probably benign 0.13
R5234:Sgsm3 UTSW 15 81007944 missense probably damaging 1.00
R5288:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5385:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5386:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R6052:Sgsm3 UTSW 15 81009263 missense probably benign
R6349:Sgsm3 UTSW 15 81008346 missense probably benign 0.00
R6453:Sgsm3 UTSW 15 81011314 missense probably damaging 0.96
R6486:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R6591:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6642:Sgsm3 UTSW 15 81009700 missense probably damaging 0.99
R6691:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6897:Sgsm3 UTSW 15 81008894 missense probably benign 0.00
R7038:Sgsm3 UTSW 15 81008375 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCTCAGTGAACAGGTCCTACAC -3'
(R):5'- TTCCTCCTGTGCACAGAACAG -3'

Sequencing Primer
(F):5'- CTACACCTGTGGCTGGAGGTTC -3'
(R):5'- TGTGCACAGAACAGCCCCAG -3'
Posted On2016-11-09