Incidental Mutation 'R5683:Acad11'
ID443189
Institutional Source Beutler Lab
Gene Symbol Acad11
Ensembl Gene ENSMUSG00000090150
Gene Nameacyl-Coenzyme A dehydrogenase family, member 11
Synonyms5730439E10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location104063377-104127725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104084283 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 397 (E397G)
Ref Sequence ENSEMBL: ENSMUSP00000141064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047799] [ENSMUST00000120854] [ENSMUST00000189998]
Predicted Effect probably damaging
Transcript: ENSMUST00000047799
AA Change: E397G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150
AA Change: E397G

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050139
SMART Domains Protein: ENSMUSP00000062941
Gene: ENSMUSG00000041748

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120854
AA Change: E279G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150
AA Change: E279G

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189998
AA Change: E397G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26. Naturally occurring read-through transcription occurs between the upstream gene NPHP3 (nephronophthisis 3 (adolescent)) and this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A C 11: 72,202,440 M22R probably benign Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc138 C A 10: 58,540,819 Q425K probably damaging Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Met A G 6: 17,571,744 Y1354C probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Olfr138 G A 17: 38,275,546 M258I possibly damaging Het
Pak6 T A 2: 118,693,912 Y469N probably damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Zc3hav1 A G 6: 38,307,237 V981A probably damaging Het
Other mutations in Acad11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Acad11 APN 9 104126656 missense probably damaging 1.00
IGL01100:Acad11 APN 9 104076408 missense probably damaging 0.98
IGL01920:Acad11 APN 9 104063905 critical splice donor site probably null
IGL02019:Acad11 APN 9 104115345 missense probably damaging 1.00
IGL02506:Acad11 APN 9 104091732 critical splice donor site probably null
IGL02742:Acad11 APN 9 104095625 missense probably damaging 1.00
IGL02830:Acad11 APN 9 104075919 missense probably damaging 1.00
IGL02936:Acad11 APN 9 104113512 missense probably benign 0.31
R0092:Acad11 UTSW 9 104090341 splice site probably benign
R0277:Acad11 UTSW 9 104124025 missense probably damaging 1.00
R0377:Acad11 UTSW 9 104081692 splice site probably benign
R0411:Acad11 UTSW 9 104116296 missense probably damaging 1.00
R0556:Acad11 UTSW 9 104115302 missense probably damaging 1.00
R0594:Acad11 UTSW 9 104095563 missense probably benign 0.09
R0688:Acad11 UTSW 9 104124100 missense probably damaging 1.00
R1416:Acad11 UTSW 9 104073623 missense probably damaging 0.96
R1551:Acad11 UTSW 9 104126586 missense probably damaging 0.99
R1730:Acad11 UTSW 9 104063882 missense probably benign 0.02
R1819:Acad11 UTSW 9 104114539 critical splice donor site probably null
R1884:Acad11 UTSW 9 104114485 missense probably benign 0.13
R2411:Acad11 UTSW 9 104086023 intron probably benign
R3055:Acad11 UTSW 9 104076336 missense probably damaging 0.98
R3683:Acad11 UTSW 9 104115344 missense probably damaging 1.00
R3954:Acad11 UTSW 9 104086152 intron probably benign
R3956:Acad11 UTSW 9 104086152 intron probably benign
R4425:Acad11 UTSW 9 104073645 missense probably damaging 1.00
R4557:Acad11 UTSW 9 104082839 missense probably benign 0.00
R4701:Acad11 UTSW 9 104095565 nonsense probably null
R4764:Acad11 UTSW 9 104075877 missense probably damaging 0.99
R4872:Acad11 UTSW 9 104086266 intron probably benign
R5132:Acad11 UTSW 9 104126592 missense probably benign 0.03
R5161:Acad11 UTSW 9 104124028 missense probably benign 0.19
R5222:Acad11 UTSW 9 104097377 missense probably damaging 1.00
R5587:Acad11 UTSW 9 104063767 missense probably benign
R6512:Acad11 UTSW 9 104095559 nonsense probably null
R6815:Acad11 UTSW 9 104081327 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAATGACTTTGGACACCTTTGTAACC -3'
(R):5'- GGTCACCGCCTTAGCAAAAG -3'

Sequencing Primer
(F):5'- TGGACACCTTTGTAACCTTCTC -3'
(R):5'- GGCAACTGGATGTAATGTTTCACTCC -3'
Posted On2016-11-09