Incidental Mutation 'H8562:Xirp2'
ID44320
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Namexin actin-binding repeat containing 2
Synonyms2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta
Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #H8562 (G3) of strain 604
Quality Score225
Status Validated
Chromosome2
Chromosomal Location67446002-67526614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67515457 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2681 (T2681A)
Ref Sequence ENSEMBL: ENSMUSP00000107966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
Predicted Effect probably benign
Transcript: ENSMUST00000028410
AA Change: T2681A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: T2681A

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112347
AA Change: T2681A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: T2681A

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142314
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dync1h1 T C 12: 110,616,807 M446T probably benign Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Macf1 A G 4: 123,466,040 V1817A probably benign Het
Mknk2 A G 10: 80,668,934 probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mtrr T C 13: 68,564,377 H630R probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osbpl3 A T 6: 50,347,466 N190K probably benign Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vcp T A 4: 42,982,596 I699F probably damaging Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67513375 missense probably benign 0.37
IGL00336:Xirp2 APN 2 67512598 missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67514882 missense probably benign 0.08
IGL00862:Xirp2 APN 2 67516903 missense probably benign 0.00
IGL01124:Xirp2 APN 2 67508615 missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67513181 missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67515184 missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67513990 missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67509677 missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67514083 missense probably benign 0.00
IGL01413:Xirp2 APN 2 67509926 missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67513505 missense probably benign
IGL01672:Xirp2 APN 2 67508502 missense probably benign
IGL01724:Xirp2 APN 2 67526067 missense probably benign
IGL01739:Xirp2 APN 2 67515138 missense probably benign 0.15
IGL01807:Xirp2 APN 2 67515031 missense probably benign
IGL02006:Xirp2 APN 2 67511962 missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67508981 missense probably benign 0.06
IGL02066:Xirp2 APN 2 67526071 missense probably benign
IGL02138:Xirp2 APN 2 67516956 missense probably benign 0.15
IGL02250:Xirp2 APN 2 67514012 missense probably benign 0.03
IGL02265:Xirp2 APN 2 67517150 missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67508651 missense probably benign 0.12
IGL02322:Xirp2 APN 2 67508738 missense probably benign 0.00
IGL02327:Xirp2 APN 2 67510100 missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67513768 missense probably benign 0.00
IGL02492:Xirp2 APN 2 67516167 missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67513102 missense probably benign 0.03
IGL02578:Xirp2 APN 2 67511247 missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67507910 missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67514671 missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67509458 missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67509136 missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67515676 missense probably benign 0.33
IGL03003:Xirp2 APN 2 67515562 missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67509532 missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67516310 missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67482246 missense probably benign 0.01
IGL03381:Xirp2 APN 2 67514226 missense probably benign 0.34
IGL03394:Xirp2 APN 2 67515194 missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67508198 missense possibly damaging 0.95
PIT4142001:Xirp2 UTSW 2 67519362 splice site probably benign
PIT4260001:Xirp2 UTSW 2 67511597 missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67509772 missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67515482 missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67510899 nonsense probably null
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67512140 missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67519278 missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67508378 missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67517120 missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67517124 missense probably benign
R0282:Xirp2 UTSW 2 67513380 missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67514918 missense probably benign 0.02
R0481:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67514821 missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67514414 missense probably benign 0.00
R0557:Xirp2 UTSW 2 67516351 missense probably benign 0.33
R0582:Xirp2 UTSW 2 67508866 missense probably benign
R0723:Xirp2 UTSW 2 67512215 missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67507910 missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67509887 missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67525067 missense probably benign 0.00
R1513:Xirp2 UTSW 2 67511530 missense probably benign 0.00
R1514:Xirp2 UTSW 2 67514323 nonsense probably null
R1519:Xirp2 UTSW 2 67515679 missense probably benign 0.44
R1532:Xirp2 UTSW 2 67513939 missense probably benign 0.00
R1537:Xirp2 UTSW 2 67510013 missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67512290 missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67508039 missense probably benign
R1607:Xirp2 UTSW 2 67510295 nonsense probably null
R1620:Xirp2 UTSW 2 67510835 missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67509871 missense probably benign 0.33
R1713:Xirp2 UTSW 2 67512418 missense probably benign 0.25
R1828:Xirp2 UTSW 2 67515238 missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67511140 missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67512615 missense probably benign 0.34
R1971:Xirp2 UTSW 2 67511695 missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67510201 missense probably benign 0.33
R2132:Xirp2 UTSW 2 67508048 missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67509914 missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67526247 missense probably benign 0.19
R2338:Xirp2 UTSW 2 67510770 missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67514471 missense probably benign 0.02
R2483:Xirp2 UTSW 2 67524992 missense probably benign
R3084:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67510147 missense probably benign 0.33
R3903:Xirp2 UTSW 2 67508036 missense probably benign 0.40
R3916:Xirp2 UTSW 2 67511422 missense probably benign 0.25
R3928:Xirp2 UTSW 2 67511669 missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67511402 missense probably benign 0.12
R4135:Xirp2 UTSW 2 67525397 missense probably benign 0.00
R4223:Xirp2 UTSW 2 67516493 missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67516039 missense probably benign 0.31
R4499:Xirp2 UTSW 2 67513438 missense probably benign 0.08
R4577:Xirp2 UTSW 2 67513897 missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67519265 missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67516535 missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67516406 missense probably benign 0.26
R4855:Xirp2 UTSW 2 67511064 missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67512893 missense probably benign
R4936:Xirp2 UTSW 2 67509819 missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67525670 missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67517134 missense probably benign 0.03
R5077:Xirp2 UTSW 2 67514477 missense probably benign
R5090:Xirp2 UTSW 2 67525470 missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67509710 missense probably damaging 0.99
R5107:Xirp2 UTSW 2 67511861 missense probably damaging 1.00
R5187:Xirp2 UTSW 2 67515367 missense probably benign 0.01
R5241:Xirp2 UTSW 2 67482360 nonsense probably null
R5307:Xirp2 UTSW 2 67511162 missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67512152 missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67511906 missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67510969 missense probably benign 0.33
R5514:Xirp2 UTSW 2 67505121 missense probably benign 0.03
R5531:Xirp2 UTSW 2 67515302 missense probably benign 0.42
R5590:Xirp2 UTSW 2 67514035 missense probably benign 0.23
R5646:Xirp2 UTSW 2 67510790 missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67516895 missense probably benign 0.00
R5686:Xirp2 UTSW 2 67482298 missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67510967 missense probably benign 0.00
R5777:Xirp2 UTSW 2 67510004 missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67509662 missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67476785 start gained probably benign
R5846:Xirp2 UTSW 2 67509243 missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67505080 missense probably benign 0.00
R5896:Xirp2 UTSW 2 67508698 missense probably benign 0.32
R5896:Xirp2 UTSW 2 67509946 missense possibly damaging 0.91
R5901:Xirp2 UTSW 2 67513066 missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67524804 missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67511320 missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67510943 missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67508243 missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67511817 missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67505577 critical splice donor site probably null
R6342:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67516081 missense probably benign 0.00
R6603:Xirp2 UTSW 2 67516544 missense probably benign
R6604:Xirp2 UTSW 2 67509845 missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67513355 missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67516225 missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67512868 missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67509950 missense probably benign 0.12
R6897:Xirp2 UTSW 2 67508567 missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67514857 missense probably benign 0.34
R7020:Xirp2 UTSW 2 67525569 missense probably benign
R7042:Xirp2 UTSW 2 67513289 missense probably benign 0.12
R7060:Xirp2 UTSW 2 67515608 missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67509833 missense probably benign 0.00
R7229:Xirp2 UTSW 2 67525551 missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67513482 missense probably benign
R7284:Xirp2 UTSW 2 67516829 missense probably benign
R7450:Xirp2 UTSW 2 67509815 missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67510634 missense probably benign 0.01
R7489:Xirp2 UTSW 2 67525560 missense possibly damaging 0.83
X0063:Xirp2 UTSW 2 67516123 missense probably benign 0.04
X0065:Xirp2 UTSW 2 67515118 missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67513321 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCCAGTCTTACAATGCTACGCAAG -3'
(R):5'- ATTACGGGTTGCTGCCTCAGGATG -3'

Sequencing Primer
(F):5'- TGCTACGCAAGAGAAAACATGC -3'
(R):5'- AAGAAGCATCTCCTCGGCTTG -3'
Posted On2013-06-11