Incidental Mutation 'R5684:Creb3l1'
ID443215
Institutional Source Beutler Lab
Gene Symbol Creb3l1
Ensembl Gene ENSMUSG00000027230
Gene NamecAMP responsive element binding protein 3-like 1
SynonymsBBF-2 (drosophila) homolog, Oasis
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91982328-92024502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91990731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 336 (V336A)
Ref Sequence ENSEMBL: ENSMUSP00000028663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028663]
Predicted Effect probably damaging
Transcript: ENSMUST00000028663
AA Change: V336A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028663
Gene: ENSMUSG00000027230
AA Change: V336A

DomainStartEndE-ValueType
low complexity region 49 61 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
BRLZ 288 352 8.06e-19 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is normally found in the membrane of the endoplasmic reticulum (ER). However, upon stress to the ER, the encoded protein is cleaved and the released cytoplasmic transcription factor domain translocates to the nucleus. There it activates the transcription of target genes by binding to box-B elements. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, fragile skeleton, and decreased bone density, cortical and trabecular thickness, and osteoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Creb3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Creb3l1 APN 2 92024101 missense possibly damaging 0.94
IGL01963:Creb3l1 APN 2 91993333 missense probably benign 0.00
IGL02618:Creb3l1 APN 2 91983198 missense probably benign 0.00
IGL03088:Creb3l1 APN 2 91995394 missense probably benign 0.00
R0609:Creb3l1 UTSW 2 91987053 missense possibly damaging 0.93
R1891:Creb3l1 UTSW 2 91987040 missense probably damaging 1.00
R2298:Creb3l1 UTSW 2 91991976 missense probably damaging 1.00
R2912:Creb3l1 UTSW 2 91987053 missense possibly damaging 0.93
R3084:Creb3l1 UTSW 2 91995444 splice site probably null
R3085:Creb3l1 UTSW 2 91995444 splice site probably null
R3151:Creb3l1 UTSW 2 92002033 missense probably damaging 0.96
R3945:Creb3l1 UTSW 2 91991211 missense probably damaging 1.00
R4175:Creb3l1 UTSW 2 91983175 missense probably benign 0.01
R4302:Creb3l1 UTSW 2 91993319 missense probably damaging 1.00
R4999:Creb3l1 UTSW 2 91983226 missense probably benign
R5035:Creb3l1 UTSW 2 91987086 missense probably benign 0.34
R5750:Creb3l1 UTSW 2 91986263 missense possibly damaging 0.90
R5860:Creb3l1 UTSW 2 92024054 missense probably benign 0.00
R6144:Creb3l1 UTSW 2 91992005 missense possibly damaging 0.66
R6171:Creb3l1 UTSW 2 91991269 missense probably damaging 0.99
R6239:Creb3l1 UTSW 2 91995403 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGTCTAGAGTTATGTGCAGTC -3'
(R):5'- TGCCACATTCAGGACAGGAC -3'

Sequencing Primer
(F):5'- TTATGTGCAGTCAGGGACACC -3'
(R):5'- GACCCCAACCTGGTGTCAC -3'
Posted On2016-11-09