Incidental Mutation 'R5684:Olfr159'
ID443219
Institutional Source Beutler Lab
Gene Symbol Olfr159
Ensembl Gene ENSMUSG00000044801
Gene Nameolfactory receptor 159
SynonymsOlfr37e, mOR37e, MOR262-5, GA_x6K02T2N78B-16165641-16166600
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43770050-43771009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43770624 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 129 (N129S)
Ref Sequence ENSEMBL: ENSMUSP00000060784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053931]
Predicted Effect probably benign
Transcript: ENSMUST00000053931
AA Change: N129S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000060784
Gene: ENSMUSG00000044801
AA Change: N129S

DomainStartEndE-ValueType
Pfam:7tm_4 32 315 6.9e-60 PFAM
Pfam:7tm_1 42 297 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120783
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Olfr159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Olfr159 APN 4 43770112 missense probably damaging 1.00
IGL02701:Olfr159 APN 4 43770366 missense probably benign 0.31
IGL02839:Olfr159 APN 4 43770943 nonsense probably null
IGL02956:Olfr159 APN 4 43770399 missense probably benign 0.15
IGL03058:Olfr159 APN 4 43770255 missense probably damaging 1.00
R1164:Olfr159 UTSW 4 43770991 missense probably benign 0.03
R1796:Olfr159 UTSW 4 43770495 missense possibly damaging 0.90
R1812:Olfr159 UTSW 4 43770230 nonsense probably null
R4906:Olfr159 UTSW 4 43770476 missense possibly damaging 0.76
R5426:Olfr159 UTSW 4 43770168 missense probably benign 0.04
R6002:Olfr159 UTSW 4 43770063 missense probably benign
R7174:Olfr159 UTSW 4 43770691 missense not run
R7431:Olfr159 UTSW 4 43770882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCATGCTGATGACATTG -3'
(R):5'- TCCTGGACATCTGCTACACC -3'

Sequencing Primer
(F):5'- ATGTCAGCACAGGCCAGTTTC -3'
(R):5'- TGGACATCTGCTACACCACCTC -3'
Posted On2016-11-09