Incidental Mutation 'R5684:Olfr487'
ID443233
Institutional Source Beutler Lab
Gene Symbol Olfr487
Ensembl Gene ENSMUSG00000095929
Gene Nameolfactory receptor 487
SynonymsMOR204-31P, MOR204-29P, GA_x6K02T2PBJ9-10541702-10540758, Olfr1538-ps1, MOR204-31P
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108208868-108214636 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 108212072 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 152 (Y152*)
Ref Sequence ENSEMBL: ENSMUSP00000149407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081996] [ENSMUST00000216489]
Predicted Effect probably null
Transcript: ENSMUST00000081996
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000080657
Gene: ENSMUSG00000095929
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 6.1e-50 PFAM
Pfam:7tm_1 44 293 1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216489
AA Change: Y152*
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Olfr487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr487 APN 7 108211726 missense probably benign 0.06
IGL03133:Olfr487 APN 7 108212387 missense possibly damaging 0.94
IGL03326:Olfr487 APN 7 108211630 missense probably benign 0.03
R0141:Olfr487 UTSW 7 108212003 missense possibly damaging 0.59
R0344:Olfr487 UTSW 7 108211742 nonsense probably null
R0595:Olfr487 UTSW 7 108211661 missense probably damaging 1.00
R1427:Olfr487 UTSW 7 108212094 missense probably benign 0.07
R2023:Olfr487 UTSW 7 108211842 missense probably damaging 1.00
R2065:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R2068:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R3410:Olfr487 UTSW 7 108212283 missense possibly damaging 0.95
R4024:Olfr487 UTSW 7 108211742 nonsense probably null
R4619:Olfr487 UTSW 7 108212094 missense possibly damaging 0.78
R4738:Olfr487 UTSW 7 108211994 missense probably damaging 0.99
R5004:Olfr487 UTSW 7 108212116 nonsense probably null
R6782:Olfr487 UTSW 7 108212463 missense probably benign 0.03
R6889:Olfr487 UTSW 7 108211918 missense probably benign 0.00
R7010:Olfr487 UTSW 7 108212142 missense probably damaging 0.98
R7076:Olfr487 UTSW 7 108211998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGAGTGCATCTTCAGG -3'
(R):5'- CTACCTTGGATGTGGCATACAG -3'

Sequencing Primer
(F):5'- CTTCAGGATGGTGATGACAATATAG -3'
(R):5'- ATGTGGCATACAGCTCAGCTCAG -3'
Posted On2016-11-09