Incidental Mutation 'R5684:Plppr3'
ID443242
Institutional Source Beutler Lab
Gene Symbol Plppr3
Ensembl Gene ENSMUSG00000035835
Gene Namephospholipid phosphatase related 3
SynonymsBC005764, Lppr3
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5684 (G1)
Quality Score210
Status Not validated
Chromosome10
Chromosomal Location79860475-79874634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79865317 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 564 (S564T)
Ref Sequence ENSEMBL: ENSMUSP00000089979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000092325] [ENSMUST00000095457] [ENSMUST00000165601] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000166023] [ENSMUST00000167250] [ENSMUST00000167707] [ENSMUST00000167897] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092325
AA Change: S564T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089979
Gene: ENSMUSG00000035835
AA Change: S564T

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
coiled coil region 430 460 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165601
SMART Domains Protein: ENSMUSP00000128681
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 266 7.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166023
SMART Domains Protein: ENSMUSP00000127171
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166593
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167707
SMART Domains Protein: ENSMUSP00000132994
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Blast:acidPPc 125 159 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167897
SMART Domains Protein: ENSMUSP00000127972
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170910
Predicted Effect probably benign
Transcript: ENSMUST00000172282
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184090
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteins in the lipid phosphate phosphatase (LPP) family, including PRG2, are integral membrane proteins that modulate bioactive lipid phosphates including phosphatidate, lysophosphatidate, and sphingosine-1-phosphate in the context of cell migration, neurite retraction, and mitogenesis (Brauer et al., 2003 [PubMed 12730698]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Plppr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Plppr3 APN 10 79866669 missense probably damaging 1.00
IGL01108:Plppr3 APN 10 79867521 missense probably damaging 1.00
IGL01116:Plppr3 APN 10 79866923 missense probably damaging 1.00
IGL01362:Plppr3 APN 10 79865961 missense probably damaging 1.00
IGL03065:Plppr3 APN 10 79866046 missense probably benign 0.06
R0972:Plppr3 UTSW 10 79865086 missense probably damaging 0.99
R1508:Plppr3 UTSW 10 79867540 missense probably damaging 1.00
R1844:Plppr3 UTSW 10 79866410 critical splice donor site probably null
R1907:Plppr3 UTSW 10 79874069 missense probably damaging 1.00
R1982:Plppr3 UTSW 10 79866425 missense probably damaging 1.00
R1984:Plppr3 UTSW 10 79867460 nonsense probably null
R1985:Plppr3 UTSW 10 79867460 nonsense probably null
R2116:Plppr3 UTSW 10 79865738 missense probably benign 0.01
R2355:Plppr3 UTSW 10 79865360 missense possibly damaging 0.81
R4092:Plppr3 UTSW 10 79867480 missense probably damaging 1.00
R4572:Plppr3 UTSW 10 79866063 missense probably benign 0.03
R4685:Plppr3 UTSW 10 79867525 missense probably damaging 1.00
R4824:Plppr3 UTSW 10 79865673 missense possibly damaging 0.81
R5102:Plppr3 UTSW 10 79865386 missense possibly damaging 0.84
R5212:Plppr3 UTSW 10 79862445 missense probably benign 0.00
R5584:Plppr3 UTSW 10 79866452 missense probably damaging 1.00
R5778:Plppr3 UTSW 10 79866503 missense possibly damaging 0.78
R5954:Plppr3 UTSW 10 79866126 missense probably benign 0.05
R6306:Plppr3 UTSW 10 79861732 nonsense probably null
R6357:Plppr3 UTSW 10 79865406 missense probably benign 0.06
R7134:Plppr3 UTSW 10 79865703 missense probably damaging 0.96
X0067:Plppr3 UTSW 10 79865284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CACATCACTGACTGGAGACC -3'
(R):5'- ACTCTACCCTACTGTCCAGG -3'

Sequencing Primer
(F):5'- CTGTTTACAGCTGCTTCTGAAG -3'
(R):5'- AGTCATCCTGCCTCCAAGG -3'
Posted On2016-11-09