Incidental Mutation 'R5684:Vtn'
ID443243
Institutional Source Beutler Lab
Gene Symbol Vtn
Ensembl Gene ENSMUSG00000017344
Gene Namevitronectin
SynonymsVn
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78499091-78502324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78500558 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 266 (G266S)
Ref Sequence ENSEMBL: ENSMUSP00000017488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001130] [ENSMUST00000017488] [ENSMUST00000061174] [ENSMUST00000108287] [ENSMUST00000125670]
Predicted Effect probably benign
Transcript: ENSMUST00000001130
SMART Domains Protein: ENSMUSP00000001130
Gene: ENSMUSG00000001103

DomainStartEndE-ValueType
HOX 18 80 2.05e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000017488
AA Change: G266S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017488
Gene: ENSMUSG00000017344
AA Change: G266S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 20 62 2.45e-13 SMART
HX 160 203 7.81e-8 SMART
HX 205 251 2.46e-14 SMART
HX 253 303 9.19e-5 SMART
low complexity region 358 400 N/A INTRINSIC
HX 426 473 1.59e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061174
SMART Domains Protein: ENSMUSP00000051059
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 9.5e-10 SMART
TIR 561 702 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108287
SMART Domains Protein: ENSMUSP00000103922
Gene: ENSMUSG00000050132

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
low complexity region 221 236 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
SAM 409 476 1.46e-19 SMART
SAM 479 548 2.15e-8 SMART
TIR 601 742 6.73e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125670
SMART Domains Protein: ENSMUSP00000129606
Gene: ENSMUSG00000001103

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153628
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the pexin family. It is found in serum and tissues and promotes cell adhesion and spreading, inhibits the membrane-damaging effect of the terminal cytolytic complement pathway, and binds to several serpin serine protease inhibitors. It is a secreted protein and exists in either a single chain form or a clipped, two chain form held together by a disulfide bond. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes and heterozygotes for a targeted null mutation appear to develop, mature, and reproduce normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Naip6 T A 13: 100,300,380 Q545L probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Vtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Vtn APN 11 78499374 missense probably benign
IGL02515:Vtn APN 11 78501654 missense probably damaging 1.00
R0722:Vtn UTSW 11 78500854 unclassified probably benign
R1071:Vtn UTSW 11 78501776 missense probably benign 0.00
R1738:Vtn UTSW 11 78499596 missense possibly damaging 0.88
R1848:Vtn UTSW 11 78500567 missense probably damaging 0.99
R1980:Vtn UTSW 11 78501898 missense probably damaging 0.98
R1998:Vtn UTSW 11 78499716 missense probably damaging 1.00
R2125:Vtn UTSW 11 78500223 missense probably damaging 1.00
R4322:Vtn UTSW 11 78500090 unclassified probably benign
R4590:Vtn UTSW 11 78502206 missense probably damaging 1.00
R4771:Vtn UTSW 11 78501574 missense probably benign
R6177:Vtn UTSW 11 78500010 missense probably damaging 1.00
R6716:Vtn UTSW 11 78500226 missense probably damaging 1.00
R7202:Vtn UTSW 11 78500800 missense possibly damaging 0.88
X0058:Vtn UTSW 11 78499952 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCAGTCAGGGACTCC -3'
(R):5'- GTTGCTGCTGAAATTCGTACTC -3'

Sequencing Primer
(F):5'- CAGCCAGTTTAGGATATAGGACTGC -3'
(R):5'- CCCAGTACTGCTTCCCTGAGG -3'
Posted On2016-11-09