Incidental Mutation 'R5684:Naip6'
ID443245
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission 043178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5684 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100300380 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 545 (Q545L)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably damaging
Transcript: ENSMUST00000042220
AA Change: Q545L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: Q545L

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118574
AA Change: Q545L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: Q545L

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 114,879,560 D144G possibly damaging Het
4933406M09Rik A G 1: 134,389,922 D144G probably benign Het
AU040320 A G 4: 126,792,146 T172A probably benign Het
Bspry T C 4: 62,496,282 F371L possibly damaging Het
Cacna1c A G 6: 118,687,044 F555L probably damaging Het
Colec12 T C 18: 9,849,009 S396P probably damaging Het
Creb3l1 A G 2: 91,990,731 V336A probably damaging Het
Crocc T C 4: 141,051,144 N85S probably damaging Het
Dcbld2 T C 16: 58,449,809 S278P possibly damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ercc4 T A 16: 13,130,601 C561S probably benign Het
Gab1 T C 8: 80,769,670 K637R probably damaging Het
Grm5 T C 7: 88,130,645 S1130P probably benign Het
H2-M10.6 A T 17: 36,813,854 N221I probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Kcnh5 T A 12: 75,137,649 K100I probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Olfr159 T C 4: 43,770,624 N129S probably benign Het
Olfr487 A T 7: 108,212,072 Y152* probably null Het
Olfr488 A T 7: 108,256,039 I33N possibly damaging Het
Pidd1 A T 7: 141,441,111 probably null Het
Plec A G 15: 76,205,596 probably null Het
Plekhh2 C T 17: 84,597,918 A1080V probably damaging Het
Plppr3 A T 10: 79,865,317 S564T possibly damaging Het
Ppp2ca A G 11: 52,113,327 K104E probably damaging Het
Rad54l T A 4: 116,100,563 K407M probably damaging Het
Sfn T A 4: 133,601,292 K160* probably null Het
Slc22a15 A G 3: 101,862,955 S439P probably damaging Het
Slc6a2 T A 8: 92,989,053 V273D probably damaging Het
Slc9a9 T C 9: 95,055,508 F471S possibly damaging Het
Smc3 A G 19: 53,640,804 E896G probably benign Het
Sorbs3 C T 14: 70,181,222 R717Q probably damaging Het
Spg11 T C 2: 122,093,503 E779G probably damaging Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Trmt11 A G 10: 30,547,710 S400P probably damaging Het
Trpc6 T C 9: 8,653,128 V567A probably damaging Het
Vmn2r103 T G 17: 19,792,989 I124S probably benign Het
Vps13a A T 19: 16,699,045 M1188K probably benign Het
Vtn G A 11: 78,500,558 G266S probably damaging Het
Yeats2 T C 16: 20,193,803 S640P possibly damaging Het
Zc3hav1 A T 6: 38,311,279 M874K probably benign Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100300701 missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100316019 missense probably damaging 1.00
R7353:Naip6 UTSW 13 100299751 missense probably benign 0.00
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTTCCACACAGATTATGTCATG -3'
(R):5'- TTTCTCTGGGCATCAGGATG -3'

Sequencing Primer
(F):5'- ATAGAAGGGAAACTCTTGGATCTC -3'
(R):5'- ATGCTGCCCCCTGTTGTACAG -3'
Posted On2016-11-09