Incidental Mutation 'R5685:Slc2a8'
ID443262
Institutional Source Beutler Lab
Gene Symbol Slc2a8
Ensembl Gene ENSMUSG00000026791
Gene Namesolute carrier family 2, (facilitated glucose transporter), member 8
SynonymsD2Ertd44e, GlutX1, GLUT8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R5685 (G1)
Quality Score155
Status Not validated
Chromosome2
Chromosomal Location32972990-32982083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32981789 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 51 (I51V)
Ref Sequence ENSEMBL: ENSMUSP00000028129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028129] [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381] [ENSMUST00000153484] [ENSMUST00000193695] [ENSMUST00000194066] [ENSMUST00000195863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028129
AA Change: I51V

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028129
Gene: ENSMUSG00000026791
AA Change: I51V

DomainStartEndE-ValueType
Pfam:MFS_1 26 425 2e-22 PFAM
Pfam:Sugar_tr 29 474 2.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049618
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102810
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130769
Predicted Effect probably benign
Transcript: ENSMUST00000137381
Predicted Effect probably benign
Transcript: ENSMUST00000153484
AA Change: I51V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141959
Gene: ENSMUSG00000026791
AA Change: I51V

DomainStartEndE-ValueType
Pfam:MFS_1 26 296 1.4e-18 PFAM
Pfam:Sugar_tr 29 295 1.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191777
Predicted Effect possibly damaging
Transcript: ENSMUST00000193695
AA Change: I51V

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142100
Gene: ENSMUSG00000026791
AA Change: I51V

DomainStartEndE-ValueType
Pfam:MFS_1 26 290 1.2e-18 PFAM
Pfam:Sugar_tr 29 290 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194066
SMART Domains Protein: ENSMUSP00000141969
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195863
SMART Domains Protein: ENSMUSP00000141879
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 60 8.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for one null allele show reduced spermatozoan ATP levels, mitochondrial membrane potential and sperm motility, and a slight deviation from the expected Mendelian frequency. Homozygotes for another null allele show increased hippocampus cell proliferation and cardiac P-wave duration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Slc2a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc2a8 APN 2 32973624 missense probably damaging 0.99
IGL01341:Slc2a8 APN 2 32975991 missense probably damaging 1.00
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0243:Slc2a8 UTSW 2 32980104 intron probably benign
R0530:Slc2a8 UTSW 2 32973684 missense probably benign 0.32
R0972:Slc2a8 UTSW 2 32975367 missense probably benign
R1919:Slc2a8 UTSW 2 32980079 missense probably damaging 1.00
R2015:Slc2a8 UTSW 2 32981380 missense probably benign 0.01
R2893:Slc2a8 UTSW 2 32974954 missense probably damaging 1.00
R5144:Slc2a8 UTSW 2 32981773 missense probably damaging 0.96
R5744:Slc2a8 UTSW 2 32976028 missense probably benign 0.00
R6717:Slc2a8 UTSW 2 32976177 missense probably damaging 1.00
X0061:Slc2a8 UTSW 2 32975448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGATGACAGCAAAGCCAGTC -3'
(R):5'- AGCATCCCATTGGTCACTCC -3'

Sequencing Primer
(F):5'- AAGAGGCTCAGCTTGCG -3'
(R):5'- ATTGGTCACTCCTGCAGCG -3'
Posted On2016-11-09