Incidental Mutation 'R5685:Olfr1042'
ID443263
Institutional Source Beutler Lab
Gene Symbol Olfr1042
Ensembl Gene ENSMUSG00000075202
Gene Nameolfactory receptor 1042
SynonymsMOR185-10, GA_x6K02T2Q125-47629317-47628376
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86156743-86161838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86159795 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 192 (T192A)
Ref Sequence ENSEMBL: ENSMUSP00000151053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably benign
Transcript: ENSMUST00000099907
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099908
AA Change: T192A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202
AA Change: T192A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably damaging
Transcript: ENSMUST00000215624
AA Change: T192A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Olfr1042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Olfr1042 APN 2 86160047 missense probably benign 0.04
IGL02071:Olfr1042 APN 2 86159875 missense probably benign
IGL02935:Olfr1042 APN 2 86160370 unclassified probably benign
IGL03152:Olfr1042 APN 2 86159686 missense possibly damaging 0.95
R0089:Olfr1042 UTSW 2 86159574 missense possibly damaging 0.89
R1419:Olfr1042 UTSW 2 86159429 makesense probably null
R1699:Olfr1042 UTSW 2 86159936 missense probably benign
R1804:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3609:Olfr1042 UTSW 2 86159632 missense probably benign 0.00
R3953:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3955:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3956:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3957:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R4771:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R6241:Olfr1042 UTSW 2 86160036 missense probably damaging 1.00
R6324:Olfr1042 UTSW 2 86159456 missense probably benign
R6678:Olfr1042 UTSW 2 86160185 missense probably damaging 0.98
R6921:Olfr1042 UTSW 2 86159852 missense probably benign 0.02
R7215:Olfr1042 UTSW 2 86159456 missense probably benign
R7386:Olfr1042 UTSW 2 86159530 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTTGGGCTGCAAGTACATAAAAC -3'
(R):5'- TATGTGGCCATCTGGAATCCC -3'

Sequencing Primer
(F):5'- GGGCTGCAAGTACATAAAACTTACTG -3'
(R):5'- GGAATCCCCTCCTCTATGCGG -3'
Posted On2016-11-09