Incidental Mutation 'R5685:Insrr'
ID443268
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Nameinsulin receptor-related receptor
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R5685 (G1)
Quality Score205
Status Not validated
Chromosome3
Chromosomal Location87796951-87816101 bp(+) (GRCm38)
Type of Mutationintron (23728 bp from exon)
DNA Base Change (assembly) T to C at 87800496 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: Y82H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: Y82H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: Y82H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: Y82H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166866
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 intron probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 intron probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 intron probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCTTGGTCTGCACTG -3'
(R):5'- GATGGCAAAGTTCCTGGTTCTTC -3'

Sequencing Primer
(F):5'- AGGCTCTTGGTCTGCACTGTATTC -3'
(R):5'- TTCTCCACACGCACGGC -3'
Posted On2016-11-09