Incidental Mutation 'H8562:Macf1'
ID44327
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Namemicrotubule-actin crosslinking factor 1
Synonymstrabeculin alpha, Acf7, Aclp7
Accession Numbers

Ncbi RefSeq: NM_001199136.1, NM_001199137.1; MGI:108559

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8562 (G3) of strain 604
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123349633-123684360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123466040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1817 (V1817A)
Ref Sequence ENSEMBL: ENSMUSP00000101819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106213] [ENSMUST00000106220] [ENSMUST00000106224] [ENSMUST00000134458] [ENSMUST00000147030] [ENSMUST00000147228] [ENSMUST00000151346]
Predicted Effect probably benign
Transcript: ENSMUST00000082108
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084301
AA Change: V3382A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: V3382A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097897
AA Change: V3382A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: V3382A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106213
AA Change: V1817A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101819
Gene: ENSMUSG00000028649
AA Change: V1817A

DomainStartEndE-ValueType
PLEC 12 49 1.9e0 SMART
PLEC 51 88 1.38e1 SMART
PLEC 89 126 1.3e1 SMART
PLEC 130 164 2.1e1 SMART
PLEC 166 202 2.23e-2 SMART
PLEC 203 240 3.32e-10 SMART
PLEC 243 278 8.32e-2 SMART
PLEC 279 316 6.42e0 SMART
PLEC 319 354 3e2 SMART
low complexity region 421 432 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
PLEC 710 747 6.97e-4 SMART
PLEC 782 823 2.68e-5 SMART
PLEC 824 861 1.84e-3 SMART
PLEC 882 919 1.01e0 SMART
PLEC 920 957 3.38e-2 SMART
PLEC 958 996 2.39e1 SMART
PLEC 1021 1068 4.99e1 SMART
PLEC 1106 1143 1.05e-7 SMART
PLEC 1144 1181 3.57e-1 SMART
low complexity region 1375 1385 N/A INTRINSIC
coiled coil region 1790 1823 N/A INTRINSIC
low complexity region 1854 1864 N/A INTRINSIC
low complexity region 1990 2011 N/A INTRINSIC
SPEC 2012 2120 3.94e-3 SMART
SPEC 2280 2390 4.03e-9 SMART
SPEC 2397 2503 1.75e-9 SMART
SPEC 2510 2612 5.57e-3 SMART
SPEC 2619 2718 4.56e0 SMART
SPEC 2725 2856 3.46e-1 SMART
SPEC 2863 2968 1.29e-7 SMART
SPEC 2975 3079 1.19e-2 SMART
SPEC 3086 3189 2.7e-1 SMART
SPEC 3196 3299 4.99e-14 SMART
SPEC 3306 3406 1.9e-5 SMART
SPEC 3413 3519 2.83e0 SMART
SPEC 3522 3624 2.14e-4 SMART
SPEC 3631 3735 3.01e-8 SMART
SPEC 3742 3844 4.48e-16 SMART
SPEC 3851 3953 4.15e-11 SMART
SPEC 3960 4062 7.07e-5 SMART
SPEC 4069 4171 2.26e-3 SMART
SPEC 4178 4280 4.29e-4 SMART
SPEC 4287 4388 9.99e-14 SMART
SPEC 4395 4501 5.79e-2 SMART
SPEC 4508 4610 6.59e-14 SMART
SPEC 4617 4720 3.7e-17 SMART
SPEC 4727 4829 1.16e-23 SMART
SPEC 4836 4939 3.58e-15 SMART
SPEC 4946 5048 2.61e-17 SMART
SPEC 5055 5158 9.38e-19 SMART
SPEC 5165 5266 2.29e-22 SMART
SPEC 5273 5375 4.99e-14 SMART
SPEC 5382 5512 1.45e-10 SMART
EFh 5546 5574 5.08e-3 SMART
EFh 5582 5610 1.17e-2 SMART
GAS2 5621 5699 8.5e-54 SMART
low complexity region 5721 5766 N/A INTRINSIC
low complexity region 5815 5840 N/A INTRINSIC
low complexity region 5857 5869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106220
SMART Domains Protein: ENSMUSP00000101827
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 5e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 1.85e-1 SMART
SPEC 1968 2078 4.03e-9 SMART
SPEC 2085 2191 1.75e-9 SMART
SPEC 2198 2300 5.57e-3 SMART
SPEC 2307 2406 4.56e0 SMART
SPEC 2413 2544 3.46e-1 SMART
SPEC 2551 2656 1.29e-7 SMART
SPEC 2663 2767 1.19e-2 SMART
SPEC 2774 2877 2.7e-1 SMART
SPEC 2884 2987 4.99e-14 SMART
SPEC 2994 3094 1.9e-5 SMART
SPEC 3101 3207 2.83e0 SMART
SPEC 3210 3312 2.14e-4 SMART
SPEC 3319 3423 3.01e-8 SMART
SPEC 3430 3532 4.48e-16 SMART
SPEC 3539 3641 1.26e-10 SMART
SPEC 3648 3750 2.26e-3 SMART
SPEC 3757 3859 4.29e-4 SMART
SPEC 3866 3967 9.99e-14 SMART
SPEC 3974 4080 5.79e-2 SMART
SPEC 4087 4189 6.59e-14 SMART
SPEC 4196 4299 3.7e-17 SMART
SPEC 4306 4408 1.16e-23 SMART
SPEC 4415 4518 3.58e-15 SMART
SPEC 4525 4627 2.61e-17 SMART
SPEC 4634 4737 9.38e-19 SMART
SPEC 4744 4845 2.29e-22 SMART
SPEC 4852 4954 4.99e-14 SMART
SPEC 4961 5091 1.45e-10 SMART
EFh 5129 5157 5.08e-3 SMART
EFh 5165 5193 1.17e-2 SMART
GAS2 5204 5282 1.59e-53 SMART
low complexity region 5304 5349 N/A INTRINSIC
low complexity region 5398 5423 N/A INTRINSIC
low complexity region 5440 5452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106224
AA Change: V3382A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: V3382A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134458
SMART Domains Protein: ENSMUSP00000119885
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
PDB:3R6N|B 3 168 5e-37 PDB
coiled coil region 178 199 N/A INTRINSIC
SPEC 410 539 2.35e0 SMART
SPEC 557 665 1.12e-7 SMART
SPEC 682 790 3.94e-3 SMART
SPEC 950 1060 4.03e-9 SMART
SPEC 1067 1173 1.75e-9 SMART
SPEC 1180 1282 5.57e-3 SMART
SPEC 1289 1388 4.56e0 SMART
SPEC 1395 1505 3.18e-1 SMART
SPEC 1512 1617 1.29e-7 SMART
SPEC 1624 1728 1.19e-2 SMART
SPEC 1735 1838 2.7e-1 SMART
SPEC 1845 1948 4.99e-14 SMART
SPEC 1955 2055 1.9e-5 SMART
SPEC 2062 2168 2.83e0 SMART
SPEC 2171 2273 2.14e-4 SMART
SPEC 2280 2384 3.01e-8 SMART
SPEC 2391 2493 4.48e-16 SMART
SPEC 2500 2602 1.26e-10 SMART
SPEC 2609 2711 2.26e-3 SMART
SPEC 2718 2820 4.29e-4 SMART
SPEC 2827 2928 9.99e-14 SMART
SPEC 2935 3041 5.79e-2 SMART
SPEC 3048 3150 6.59e-14 SMART
SPEC 3157 3260 3.7e-17 SMART
SPEC 3267 3369 1.16e-23 SMART
SPEC 3376 3479 3.58e-15 SMART
SPEC 3486 3588 2.61e-17 SMART
SPEC 3595 3698 9.38e-19 SMART
SPEC 3705 3806 2.29e-22 SMART
SPEC 3813 3915 4.99e-14 SMART
SPEC 3922 4052 1.45e-10 SMART
EFh 4086 4114 5.08e-3 SMART
EFh 4122 4150 1.17e-2 SMART
GAS2 4161 4233 2.28e-54 SMART
low complexity region 4255 4300 N/A INTRINSIC
low complexity region 4349 4374 N/A INTRINSIC
low complexity region 4391 4403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147030
SMART Domains Protein: ENSMUSP00000123246
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 38 137 5.63e-28 SMART
CH 154 251 7.49e-24 SMART
SPEC 275 378 4.11e0 SMART
SPEC 541 638 4.32e-9 SMART
SPEC 641 741 5.75e-5 SMART
Blast:SPEC 748 913 2e-82 BLAST
coiled coil region 1004 1025 N/A INTRINSIC
SPEC 1236 1365 2.35e0 SMART
SPEC 1383 1491 1.12e-7 SMART
SPEC 1508 1616 3.94e-3 SMART
Pfam:Spectrin 1773 1837 9.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147228
SMART Domains Protein: ENSMUSP00000115847
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 4e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 3.94e-3 SMART
Pfam:Spectrin 1966 2030 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151346
SMART Domains Protein: ENSMUSP00000114568
Gene: ENSMUSG00000028649

DomainStartEndE-ValueType
CH 4 85 4.88e-14 SMART
CH 102 199 7.49e-24 SMART
SPEC 223 326 4.11e0 SMART
SPEC 489 586 4.32e-9 SMART
SPEC 589 689 5.75e-5 SMART
Blast:SPEC 696 861 3e-82 BLAST
coiled coil region 952 973 N/A INTRINSIC
SPEC 1184 1313 2.35e0 SMART
SPEC 1331 1439 1.12e-7 SMART
SPEC 1456 1564 3.94e-3 SMART
SPEC 1724 1834 4.03e-9 SMART
SPEC 1841 1947 1.75e-9 SMART
SPEC 1954 2056 5.57e-3 SMART
SPEC 2063 2162 4.56e0 SMART
SPEC 2169 2300 3.46e-1 SMART
SPEC 2307 2412 1.29e-7 SMART
SPEC 2419 2523 1.19e-2 SMART
SPEC 2530 2633 2.7e-1 SMART
SPEC 2640 2743 4.99e-14 SMART
SPEC 2750 2850 1.9e-5 SMART
SPEC 2857 2963 2.83e0 SMART
SPEC 2966 3068 2.14e-4 SMART
SPEC 3075 3179 3.01e-8 SMART
SPEC 3186 3288 4.48e-16 SMART
SPEC 3295 3397 4.15e-11 SMART
SPEC 3404 3506 7.07e-5 SMART
SPEC 3513 3615 2.26e-3 SMART
SPEC 3622 3724 4.29e-4 SMART
SPEC 3731 3832 9.99e-14 SMART
SPEC 3839 3945 5.79e-2 SMART
SPEC 3952 4054 6.59e-14 SMART
SPEC 4061 4164 3.7e-17 SMART
SPEC 4171 4273 1.16e-23 SMART
SPEC 4280 4383 3.58e-15 SMART
SPEC 4390 4492 2.61e-17 SMART
SPEC 4499 4602 9.38e-19 SMART
SPEC 4609 4710 2.29e-22 SMART
SPEC 4717 4819 4.99e-14 SMART
SPEC 4826 4956 1.45e-10 SMART
EFh 4990 5018 5.08e-3 SMART
EFh 5026 5054 1.17e-2 SMART
GAS2 5065 5137 2.28e-54 SMART
low complexity region 5159 5204 N/A INTRINSIC
low complexity region 5253 5278 N/A INTRINSIC
low complexity region 5295 5307 N/A INTRINSIC
Meta Mutation Damage Score 0.1352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype Strain: 3652899; 4831019
Lethality: E7-E8
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dync1h1 T C 12: 110,616,807 M446T probably benign Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Mknk2 A G 10: 80,668,934 probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mtrr T C 13: 68,564,377 H630R probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osbpl3 A T 6: 50,347,466 N190K probably benign Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vcp T A 4: 42,982,596 I699F probably damaging Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Xirp2 A G 2: 67,515,457 T2681A probably benign Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123382122 missense probably damaging 0.99
IGL01293:Macf1 APN 4 123471311 missense probably benign 0.00
IGL01307:Macf1 APN 4 123383129 missense probably damaging 1.00
IGL01314:Macf1 APN 4 123486720 missense probably damaging 1.00
IGL01321:Macf1 APN 4 123440774 missense probably damaging 1.00
IGL01327:Macf1 APN 4 123509912 missense probably benign 0.20
IGL01365:Macf1 APN 4 123391169 missense probably damaging 1.00
IGL01465:Macf1 APN 4 123490721 missense probably benign 0.00
IGL01527:Macf1 APN 4 123493160 missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123473873 missense probably damaging 1.00
IGL01539:Macf1 APN 4 123395908 splice site probably benign
IGL01543:Macf1 APN 4 123401457 missense probably damaging 1.00
IGL01553:Macf1 APN 4 123493163 nonsense probably null
IGL01558:Macf1 APN 4 123453005 missense probably benign 0.00
IGL01633:Macf1 APN 4 123502171 missense probably damaging 0.99
IGL01684:Macf1 APN 4 123465930 missense probably damaging 1.00
IGL01715:Macf1 APN 4 123391086 missense probably damaging 1.00
IGL01844:Macf1 APN 4 123440692 missense probably benign 0.34
IGL01870:Macf1 APN 4 123474113 missense probably damaging 0.99
IGL01916:Macf1 APN 4 123441630 missense probably damaging 1.00
IGL01916:Macf1 APN 4 123476037 missense probably damaging 1.00
IGL01923:Macf1 APN 4 123380444 missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123499931 missense probably damaging 1.00
IGL02022:Macf1 APN 4 123391049 critical splice donor site probably null
IGL02084:Macf1 APN 4 123432603 missense probably benign 0.02
IGL02084:Macf1 APN 4 123459374 missense probably damaging 1.00
IGL02142:Macf1 APN 4 123472049 missense probably benign 0.11
IGL02151:Macf1 APN 4 123371766 splice site probably benign
IGL02164:Macf1 APN 4 123480272 missense probably benign 0.03
IGL02174:Macf1 APN 4 123491794 missense probably damaging 1.00
IGL02229:Macf1 APN 4 123509826 missense probably damaging 1.00
IGL02277:Macf1 APN 4 123486704 missense probably damaging 1.00
IGL02283:Macf1 APN 4 123471375 missense probably benign 0.01
IGL02314:Macf1 APN 4 123444837 missense probably damaging 0.99
IGL02327:Macf1 APN 4 123471730 missense probably benign 0.06
IGL02348:Macf1 APN 4 123512866 missense probably damaging 1.00
IGL02441:Macf1 APN 4 123387236 missense probably damaging 1.00
IGL02585:Macf1 APN 4 123472284 missense probably benign 0.00
IGL02602:Macf1 APN 4 123355163 missense probably damaging 1.00
IGL03204:Macf1 APN 4 123355277 splice site probably benign
Royal_flush UTSW 4 123365355 splice site probably null
suspension UTSW 4 123497755 missense probably damaging 1.00
voragine UTSW 4 123355102 missense probably damaging 1.00
IGL03052:Macf1 UTSW 4 123387395 missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123473321 missense probably benign 0.43
R0021:Macf1 UTSW 4 123475577 missense probably damaging 1.00
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0028:Macf1 UTSW 4 123382102 missense probably damaging 1.00
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123473868 missense probably damaging 1.00
R0106:Macf1 UTSW 4 123408564 missense probably benign 0.00
R0123:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0129:Macf1 UTSW 4 123433275 missense probably damaging 1.00
R0134:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123440747 missense probably damaging 1.00
R0145:Macf1 UTSW 4 123387397 missense probably damaging 1.00
R0195:Macf1 UTSW 4 123434916 missense probably damaging 0.99
R0227:Macf1 UTSW 4 123399391 missense probably benign 0.14
R0233:Macf1 UTSW 4 123450127 splice site probably benign
R0254:Macf1 UTSW 4 123432779 missense probably damaging 1.00
R0357:Macf1 UTSW 4 123457983 missense probably damaging 1.00
R0398:Macf1 UTSW 4 123351017 missense probably damaging 1.00
R0413:Macf1 UTSW 4 123472269 missense probably benign
R0426:Macf1 UTSW 4 123483660 nonsense probably null
R0441:Macf1 UTSW 4 123365355 splice site probably null
R0453:Macf1 UTSW 4 123444944 missense probably benign 0.35
R0481:Macf1 UTSW 4 123484022 splice site probably null
R0502:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0503:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0519:Macf1 UTSW 4 123471320 missense probably benign 0.03
R0543:Macf1 UTSW 4 123376378 missense probably damaging 1.00
R0621:Macf1 UTSW 4 123380534 missense probably damaging 1.00
R0631:Macf1 UTSW 4 123455524 nonsense probably null
R0720:Macf1 UTSW 4 123432925 missense probably damaging 1.00
R0730:Macf1 UTSW 4 123382530 splice site probably benign
R0755:Macf1 UTSW 4 123369926 missense probably damaging 0.99
R0836:Macf1 UTSW 4 123494882 critical splice donor site probably null
R0847:Macf1 UTSW 4 123399366 missense probably benign 0.03
R0850:Macf1 UTSW 4 123474402 missense probably benign
R0924:Macf1 UTSW 4 123385478 missense probably damaging 1.00
R0973:Macf1 UTSW 4 123476000 missense possibly damaging 0.76
R1025:Macf1 UTSW 4 123473816 missense probably damaging 1.00
R1076:Macf1 UTSW 4 123385598 missense probably damaging 1.00
R1253:Macf1 UTSW 4 123457967 missense probably damaging 1.00
R1301:Macf1 UTSW 4 123486658 splice site probably benign
R1337:Macf1 UTSW 4 123476275 missense probably benign 0.34
R1344:Macf1 UTSW 4 123433453 missense probably damaging 0.99
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1443:Macf1 UTSW 4 123511007 missense probably damaging 1.00
R1452:Macf1 UTSW 4 123493998 missense probably benign
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1483:Macf1 UTSW 4 123510977 missense probably damaging 1.00
R1509:Macf1 UTSW 4 123684009 missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123434762 missense probably null 1.00
R1515:Macf1 UTSW 4 123378480 missense probably damaging 1.00
R1524:Macf1 UTSW 4 123432530 missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123476014 missense probably benign 0.30
R1535:Macf1 UTSW 4 123440693 missense probably benign 0.05
R1556:Macf1 UTSW 4 123455020 missense probably damaging 1.00
R1564:Macf1 UTSW 4 123459357 missense probably benign 0.00
R1586:Macf1 UTSW 4 123509846 missense probably benign 0.20
R1626:Macf1 UTSW 4 123471534 missense probably benign
R1629:Macf1 UTSW 4 123508415 nonsense probably null
R1649:Macf1 UTSW 4 123484053 missense probably damaging 0.96
R1650:Macf1 UTSW 4 123456600 nonsense probably null
R1706:Macf1 UTSW 4 123370584 critical splice donor site probably null
R1713:Macf1 UTSW 4 123378694 missense probably damaging 1.00
R1716:Macf1 UTSW 4 123401403 missense probably damaging 1.00
R1744:Macf1 UTSW 4 123475853 missense probably damaging 1.00
R1752:Macf1 UTSW 4 123483672 missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123512108 missense probably damaging 1.00
R1812:Macf1 UTSW 4 123432024 missense probably damaging 1.00
R1818:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R1853:Macf1 UTSW 4 123512720 intron probably null
R1856:Macf1 UTSW 4 123369848 missense probably damaging 1.00
R1869:Macf1 UTSW 4 123351128 missense probably damaging 1.00
R1880:Macf1 UTSW 4 123438591 missense probably damaging 1.00
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1902:Macf1 UTSW 4 123471165 missense probably benign 0.01
R1907:Macf1 UTSW 4 123372399 missense probably damaging 1.00
R1908:Macf1 UTSW 4 123457841 missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123452037 missense probably damaging 1.00
R1944:Macf1 UTSW 4 123370666 missense probably damaging 1.00
R1945:Macf1 UTSW 4 123490660 nonsense probably null
R1975:Macf1 UTSW 4 123489212 missense probably damaging 1.00
R1989:Macf1 UTSW 4 123497726 critical splice donor site probably null
R1991:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R1992:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R2013:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R2021:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2022:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2023:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2024:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2025:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2027:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2049:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2060:Macf1 UTSW 4 123499919 unclassified probably null
R2092:Macf1 UTSW 4 123383178 missense probably damaging 1.00
R2100:Macf1 UTSW 4 123397906 nonsense probably null
R2128:Macf1 UTSW 4 123492774 missense probably benign 0.11
R2129:Macf1 UTSW 4 123368815 splice site probably benign
R2140:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2142:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2182:Macf1 UTSW 4 123492671 missense probably damaging 0.98
R2185:Macf1 UTSW 4 123475556 missense probably damaging 0.99
R2190:Macf1 UTSW 4 123459212 missense probably benign 0.11
R2320:Macf1 UTSW 4 123439495 missense probably benign 0.02
R2382:Macf1 UTSW 4 123374832 missense probably damaging 1.00
R2429:Macf1 UTSW 4 123432584 missense probably damaging 0.99
R2432:Macf1 UTSW 4 123683996 missense probably damaging 1.00
R2484:Macf1 UTSW 4 123473672 missense probably damaging 1.00
R2842:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R2912:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2913:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2914:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2938:Macf1 UTSW 4 123432902 missense probably damaging 0.99
R3082:Macf1 UTSW 4 123361443 splice site probably null
R3086:Macf1 UTSW 4 123435108 missense probably benign 0.00
R3408:Macf1 UTSW 4 123381781 missense probably damaging 1.00
R3499:Macf1 UTSW 4 123527305 nonsense probably null
R3696:Macf1 UTSW 4 123456362 missense probably damaging 1.00
R3716:Macf1 UTSW 4 123473502 missense probably benign 0.01
R3727:Macf1 UTSW 4 123459311 missense probably damaging 1.00
R3770:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3813:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3825:Macf1 UTSW 4 123444951 missense probably benign 0.11
R3893:Macf1 UTSW 4 123486406 missense probably damaging 1.00
R3896:Macf1 UTSW 4 123471194 missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123380420 missense probably damaging 1.00
R4031:Macf1 UTSW 4 123381312 missense probably damaging 1.00
R4052:Macf1 UTSW 4 123472017 missense probably benign 0.00
R4077:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4078:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4084:Macf1 UTSW 4 123450072 missense probably damaging 0.98
R4094:Macf1 UTSW 4 123459269 missense probably benign 0.00
R4154:Macf1 UTSW 4 123471813 missense probably damaging 1.00
R4190:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123432392 missense probably damaging 1.00
R4299:Macf1 UTSW 4 123399406 missense probably damaging 1.00
R4326:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4327:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4355:Macf1 UTSW 4 123475091 missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123354492 intron probably benign
R4422:Macf1 UTSW 4 123466046 missense probably damaging 0.96
R4436:Macf1 UTSW 4 123527342 missense probably benign 0.03
R4472:Macf1 UTSW 4 123395989 missense probably damaging 1.00
R4515:Macf1 UTSW 4 123493988 missense probably damaging 1.00
R4549:Macf1 UTSW 4 123473693 missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4622:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4623:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4630:Macf1 UTSW 4 123473639 missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123473627 missense probably benign 0.01
R4650:Macf1 UTSW 4 123473619 missense probably benign 0.00
R4674:Macf1 UTSW 4 123472397 missense probably benign 0.22
R4751:Macf1 UTSW 4 123471650 missense probably benign 0.01
R4762:Macf1 UTSW 4 123455444 missense probably benign 0.00
R4776:Macf1 UTSW 4 123476015 missense probably benign 0.00
R4777:Macf1 UTSW 4 123376502 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4865:Macf1 UTSW 4 123433303 missense probably damaging 1.00
R4867:Macf1 UTSW 4 123472200 missense probably damaging 0.97
R4884:Macf1 UTSW 4 123455009 missense probably benign 0.02
R4890:Macf1 UTSW 4 123448238 missense probably damaging 1.00
R4913:Macf1 UTSW 4 123499889 missense probably damaging 1.00
R4925:Macf1 UTSW 4 123526652 missense probably benign
R4948:Macf1 UTSW 4 123497755 missense probably damaging 1.00
R4958:Macf1 UTSW 4 123475364 missense probably damaging 0.99
R4986:Macf1 UTSW 4 123391121 missense probably damaging 1.00
R4999:Macf1 UTSW 4 123494909 missense probably benign 0.14
R5004:Macf1 UTSW 4 123385475 missense probably damaging 1.00
R5017:Macf1 UTSW 4 123452113 missense probably damaging 1.00
R5018:Macf1 UTSW 4 123385599 missense probably damaging 1.00
R5026:Macf1 UTSW 4 123439494 missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123455519 missense probably damaging 0.97
R5039:Macf1 UTSW 4 123511220 missense probably damaging 1.00
R5041:Macf1 UTSW 4 123397046 intron probably null
R5100:Macf1 UTSW 4 123474468 missense probably benign 0.11
R5110:Macf1 UTSW 4 123368008 missense probably damaging 0.99
R5122:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R5187:Macf1 UTSW 4 123472089 missense probably benign 0.00
R5191:Macf1 UTSW 4 123472962 missense probably benign 0.00
R5201:Macf1 UTSW 4 123475945 nonsense probably null
R5236:Macf1 UTSW 4 123397821 missense probably damaging 1.00
R5248:Macf1 UTSW 4 123401774 nonsense probably null
R5251:Macf1 UTSW 4 123449967 missense probably benign 0.20
R5319:Macf1 UTSW 4 123473436 missense probably damaging 1.00
R5326:Macf1 UTSW 4 123350991 frame shift probably null
R5327:Macf1 UTSW 4 123350991 frame shift probably null
R5328:Macf1 UTSW 4 123350991 frame shift probably null
R5350:Macf1 UTSW 4 123527458 start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123471753 missense probably damaging 0.98
R5419:Macf1 UTSW 4 123397124 missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123384868 missense probably damaging 1.00
R5432:Macf1 UTSW 4 123459336 nonsense probably null
R5466:Macf1 UTSW 4 123452865 missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123450061 missense probably benign
R5564:Macf1 UTSW 4 123526745 missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123435164 missense probably damaging 0.98
R5597:Macf1 UTSW 4 123539777 intron probably benign
R5669:Macf1 UTSW 4 123476225 missense probably damaging 1.00
R5682:Macf1 UTSW 4 123434759 missense probably damaging 1.00
R5701:Macf1 UTSW 4 123503225 missense probably damaging 1.00
R5715:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R5760:Macf1 UTSW 4 123513884 missense probably damaging 1.00
R5806:Macf1 UTSW 4 123371887 missense probably damaging 1.00
R5838:Macf1 UTSW 4 123452154 missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123381324 missense probably damaging 1.00
R5850:Macf1 UTSW 4 123507306 missense probably damaging 1.00
R5875:Macf1 UTSW 4 123432314 missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123397158 missense probably damaging 1.00
R5913:Macf1 UTSW 4 123476039 missense probably damaging 1.00
R5921:Macf1 UTSW 4 123526711 missense probably benign
R5940:Macf1 UTSW 4 123432881 missense probably damaging 1.00
R5950:Macf1 UTSW 4 123439436 splice site probably null
R6005:Macf1 UTSW 4 123474275 missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123507333 missense probably damaging 1.00
R6041:Macf1 UTSW 4 123513848 missense probably damaging 1.00
R6057:Macf1 UTSW 4 123510743 missense probably damaging 0.98
R6156:Macf1 UTSW 4 123472280 missense probably benign 0.00
R6186:Macf1 UTSW 4 123484175 missense probably damaging 1.00
R6197:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R6262:Macf1 UTSW 4 123473190 missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123432875 missense probably damaging 1.00
R6340:Macf1 UTSW 4 123448249 missense probably benign 0.13
R6369:Macf1 UTSW 4 123410562 missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123493195 missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123401594 intron probably null
R6501:Macf1 UTSW 4 123469632 unclassified probably null
R6508:Macf1 UTSW 4 123469742 missense probably damaging 0.96
R6519:Macf1 UTSW 4 123472325 missense probably benign 0.13
R6535:Macf1 UTSW 4 123471935 missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123492725 missense probably damaging 1.00
R6546:Macf1 UTSW 4 123432281 missense probably benign 0.14
R6583:Macf1 UTSW 4 123470946 intron probably null
R6597:Macf1 UTSW 4 123382692 missense probably damaging 1.00
R6693:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123509803 missense probably damaging 1.00
R6704:Macf1 UTSW 4 123410762 intron probably benign
R6716:Macf1 UTSW 4 123508438 missense probably damaging 1.00
R6789:Macf1 UTSW 4 123372438 missense probably damaging 1.00
R6807:Macf1 UTSW 4 123374415 missense probably damaging 1.00
R6825:Macf1 UTSW 4 123383222 splice site probably null
R6881:Macf1 UTSW 4 123432453 missense probably damaging 1.00
R6894:Macf1 UTSW 4 123483687 missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123527352 missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123440722 missense probably benign 0.01
R6965:Macf1 UTSW 4 123408745 missense probably benign 0.38
R6969:Macf1 UTSW 4 123457800 missense probably benign 0.01
R7032:Macf1 UTSW 4 123472308 missense probably benign 0.00
R7055:Macf1 UTSW 4 123409196 missense probably benign 0.01
R7078:Macf1 UTSW 4 123432143 missense probably damaging 0.99
R7215:Macf1 UTSW 4 123507304 missense probably damaging 1.00
R7263:Macf1 UTSW 4 123378150 missense probably damaging 1.00
R7265:Macf1 UTSW 4 123407877 missense probably benign 0.00
R7312:Macf1 UTSW 4 123506337 missense probably damaging 1.00
X0022:Macf1 UTSW 4 123450042 missense probably damaging 0.99
X0027:Macf1 UTSW 4 123503269 missense probably damaging 1.00
X0064:Macf1 UTSW 4 123511874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGAATCTGGAACTCCAAGAGTCAC -3'
(R):5'- CCACTGCTGGCCTCTCTATTGAGAAG -3'

Sequencing Primer
(F):5'- GTCACTAACAGAGTCTAGAGACTTC -3'
(R):5'- TTTGGTGGCCTCAGACAAAAC -3'
Posted On2013-06-11